EMAIL THIS PAGE TO A FRIEND

RASGRF1

Ras protein-specific guanine nucleotide-releasing factor 1

75 Gene Product Result for
Synonyms: CDC25 CDC25L GNRP GRF1 GRF55 H-GRF55 PP13187 ras-GRF1
UniProtKB ID: Q13972, Q16027
Gene ID:
Human(5923) Summary: The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
Mouse(19417) RAS protein-specific guanine nucleotide-releasing factor 1
Rat(192213) RAS protein-specific guanine nucleotide-releasing factor 1
domestic guinea pig(100731687) Ras protein-specific guanine nucleotide-releasing factor 1
naked mole-rat(101699491) Ras protein-specific guanine nucleotide-releasing factor 1
cow(520039) Ras protein-specific guanine nucleotide-releasing factor 1
sheep(101113014) Ras protein-specific guanine nucleotide-releasing factor 1
chicken(415578) Ras protein-specific guanine nucleotide-releasing factor 1
dog(488774) Ras protein-specific guanine nucleotide-releasing factor 1
Horse(100050202) Ras protein-specific guanine nucleotide-releasing factor 1
domestic cat(101092941) Ras protein-specific guanine nucleotide-releasing factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011245 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011245 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011245 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002891 Rosetta Predictions human pricing
NM_153815 Rosetta Predictions human pricing
NM_001105753 Rosetta Predictions rat pricing
NM_001039655 Rosetta Predictions mouse pricing
NM_011245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211036 predicted 3457
2 SASI_Hs01_00211037 predicted 3730
3 SASI_Hs01_00211038 predicted 3235
4 SASI_Hs01_00211039 predicted 3396
5 SASI_Hs01_00211040 predicted 3711
6 SASI_Hs01_00211041 predicted 3410
7 SASI_Hs01_00211042 predicted 3388
8 SASI_Hs01_00211044 predicted 3670
9 SASI_Hs01_00211045 predicted 3451
10 SASI_Hs02_00334693 predicted 3264
11 SASI_Hs01_00211043 predicted 3632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211542 predicted 2284
2 SASI_Hs01_00211543 predicted 2545
3 SASI_Hs01_00211544 predicted 2062
4 SASI_Hs01_00211545 predicted 2224
5 SASI_Hs01_00211546 predicted 2537
6 SASI_Hs01_00211547 predicted 2227
7 SASI_Hs01_00211548 predicted 2208
8 SASI_Hs01_00211550 predicted 2495
9 SASI_Hs01_00211551 predicted 2272
10 SASI_Hs02_00367494 predicted 2088
11 SASI_Hs01_00211549 predicted 2463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212196 predicted 882
2 SASI_Rn02_00212197 predicted 518
3 SASI_Rn02_00212198 predicted 1081
4 SASI_Rn02_00212199 predicted 585
5 SASI_Rn02_00212200 predicted 931
6 SASI_Rn02_00212201 predicted 860
7 SASI_Rn02_00212202 predicted 1170
8 SASI_Rn02_00212203 predicted 468
9 SASI_Rn02_00212204 predicted 887
10 SASI_Rn02_00212205 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290174 predicted 933
2 SASI_Mm01_00108853 predicted 906
3 SASI_Mm01_00108854 predicted 631
4 SASI_Mm01_00108855 predicted 895
5 SASI_Mm01_00108856 predicted 871
6 SASI_Mm01_00108857 predicted 539
7 SASI_Mm01_00108858 predicted 349
8 SASI_Mm01_00108859 predicted 700
9 SASI_Mm01_00108860 predicted 725
10 SASI_Mm01_00108861 predicted 905
11 SASI_Mm01_00108852 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057884 predicted 744
2 SASI_Mm01_00057886 predicted 2949
3 SASI_Mm01_00057887 predicted 3925
4 SASI_Mm02_00320236 predicted 509
5 SASI_Mm01_00057888 predicted 3084
6 SASI_Mm01_00057889 predicted 3966
7 SASI_Mm01_00057890 predicted 783
8 SASI_Mm01_00057891 predicted 4068
9 SASI_Mm01_00057892 predicted 1490
10 SASI_Mm01_00057893 predicted 1548
11 SASI_Mm01_00057885 predicted 3209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002891
RASGRF1 MISSION shRNA Bacterial Glycerol Stock
Ras protein-specific guanine nucleotide-releasing factor 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002891.4-4028s21c1
Sequence:CCGGTGAGGATGATATCCCATATTACTCGAGTAATATGGGATATCATCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-1873s1c1
Sequence:CCGGGCCTCCTTATATTGTGATGATCTCGAGATCATCACAATATAAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-3734s1c1
Sequence:CCGGCGCAATATTTACTGGACCAATCTCGAGATTGGTCCAGTAAATATTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-398s1c1
Sequence:CCGGCCACAGAGCATGAGGCATTAACTCGAGTTAATGCCTCATGCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-1557s1c1
Sequence:CCGGCCTCATTGACTGCACTTTATTCTCGAGAATAAAGTGCAGTCAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-2666s1c1
Sequence:CCGGCCTGTCGTGAACTGGACAATACTCGAGTATTGTCCAGTTCACGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002891
RASGRF1 MISSION shRNA shRNA Plasmid DNA
Ras protein-specific guanine nucleotide-releasing factor 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002891.4-4028s21c1
Sequence:CCGGTGAGGATGATATCCCATATTACTCGAGTAATATGGGATATCATCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-1873s1c1
Sequence:CCGGGCCTCCTTATATTGTGATGATCTCGAGATCATCACAATATAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-3734s1c1
Sequence:CCGGCGCAATATTTACTGGACCAATCTCGAGATTGGTCCAGTAAATATTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-398s1c1
Sequence:CCGGCCACAGAGCATGAGGCATTAACTCGAGTTAATGCCTCATGCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-1557s1c1
Sequence:CCGGCCTCATTGACTGCACTTTATTCTCGAGAATAAAGTGCAGTCAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-2666s1c1
Sequence:CCGGCCTGTCGTGAACTGGACAATACTCGAGTATTGTCCAGTTCACGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002891
RASGRF1 MISSION shRNA Lentiviral Transduction Particles
Ras protein-specific guanine nucleotide-releasing factor 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002891.4-4028s21c1
Sequence:CCGGTGAGGATGATATCCCATATTACTCGAGTAATATGGGATATCATCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-1873s1c1
Sequence:CCGGGCCTCCTTATATTGTGATGATCTCGAGATCATCACAATATAAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-3734s1c1
Sequence:CCGGCGCAATATTTACTGGACCAATCTCGAGATTGGTCCAGTAAATATTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-398s1c1
Sequence:CCGGCCACAGAGCATGAGGCATTAACTCGAGTTAATGCCTCATGCTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-1557s1c1
Sequence:CCGGCCTCATTGACTGCACTTTATTCTCGAGAATAAAGTGCAGTCAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002891.3-2666s1c1
Sequence:CCGGCCTGTCGTGAACTGGACAATACTCGAGTATTGTCCAGTTCACGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011245
RASGRF1 MISSION shRNA Bacterial Glycerol Stock
Ras protein-specific guanine nucleotide-releasing factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-489s1c1
Sequence:CCGGCGGCGAGAAACAGCAACATTACTCGAGTAATGTTGCTGTTTCTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-2071s1c1
Sequence:CCGGGCTTCCTTATATTGTGATGATCTCGAGATCATCACAATATAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-488s1c1
Sequence:CCGGCCGGCGAGAAACAGCAACATTCTCGAGAATGTTGCTGTTTCTCGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-1983s1c1
Sequence:CCGGCGTGGATAATATCCGCTGCAACTCGAGTTGCAGCGGATATTATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-3916s1c1
Sequence:CCGGCCAAAGGTAATTCAGTACTTACTCGAGTAAGTACTGAATTACCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011245
RASGRF1 MISSION shRNA shRNA Plasmid DNA
Ras protein-specific guanine nucleotide-releasing factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-489s1c1
Sequence:CCGGCGGCGAGAAACAGCAACATTACTCGAGTAATGTTGCTGTTTCTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-2071s1c1
Sequence:CCGGGCTTCCTTATATTGTGATGATCTCGAGATCATCACAATATAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-488s1c1
Sequence:CCGGCCGGCGAGAAACAGCAACATTCTCGAGAATGTTGCTGTTTCTCGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-1983s1c1
Sequence:CCGGCGTGGATAATATCCGCTGCAACTCGAGTTGCAGCGGATATTATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-3916s1c1
Sequence:CCGGCCAAAGGTAATTCAGTACTTACTCGAGTAAGTACTGAATTACCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011245
RASGRF1 MISSION shRNA Lentiviral Transduction Particles
Ras protein-specific guanine nucleotide-releasing factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-489s1c1
Sequence:CCGGCGGCGAGAAACAGCAACATTACTCGAGTAATGTTGCTGTTTCTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-2071s1c1
Sequence:CCGGGCTTCCTTATATTGTGATGATCTCGAGATCATCACAATATAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-488s1c1
Sequence:CCGGCCGGCGAGAAACAGCAACATTCTCGAGAATGTTGCTGTTTCTCGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-1983s1c1
Sequence:CCGGCGTGGATAATATCCGCTGCAACTCGAGTTGCAGCGGATATTATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011245.1-3916s1c1
Sequence:CCGGCCAAAGGTAATTCAGTACTTACTCGAGTAAGTACTGAATTACCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)