EMAIL THIS PAGE TO A FRIEND

RASGRF2

Ras protein-specific guanine nucleotide-releasing factor 2

54 Gene Product Result for
Synonyms: GRF2 RAS-GRF2
UniProtKB ID: O14827, B9EG89, Q9UK56
Gene ID:
Human(5924) Summary: RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
Mouse(19418) RAS protein-specific guanine nucleotide-releasing factor 2
Rat(114513) RAS protein-specific guanine nucleotide-releasing factor 2
chicken(100859132) Ras protein-specific guanine nucleotide-releasing factor 2
dog(610203) Ras protein-specific guanine nucleotide-releasing factor 2
Horse(100073254) Ras protein-specific guanine nucleotide-releasing factor 2
domestic cat(101091172) Ras protein-specific guanine nucleotide-releasing factor 2
cow(524957) Ras protein-specific guanine nucleotide-releasing factor 2
sheep(101121934) Ras protein-specific guanine nucleotide-releasing factor 2
naked mole-rat(101698054) Ras protein-specific guanine nucleotide-releasing factor 2
domestic guinea pig(100724898) Ras protein-specific guanine nucleotide-releasing factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006909 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006909 Rosetta Predictions human pricing
NM_053721 Rosetta Predictions rat pricing
NM_009027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086036 predicted 1564
2 SASI_Hs01_00086038 predicted 3646
3 SASI_Hs01_00086039 predicted 2395
4 SASI_Hs02_00342587 predicted 530
5 SASI_Hs01_00086040 predicted 3292
6 SASI_Hs01_00086041 predicted 426
7 SASI_Hs01_00086042 predicted 1822
8 SASI_Hs01_00086043 predicted 3588
9 SASI_Hs01_00086044 predicted 3054
10 SASI_Hs01_00086045 predicted 439
11 SASI_Hs01_00086037 predicted 2931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062695 predicted 3140
2 SASI_Rn01_00062697 predicted 474
3 SASI_Rn01_00062698 predicted 2081
4 SASI_Rn01_00062699 predicted 3304
5 SASI_Rn01_00062700 predicted 2390
6 SASI_Rn01_00062701 predicted 2969
7 SASI_Rn01_00062702 predicted 943
8 SASI_Rn01_00062703 predicted 513
9 SASI_Rn01_00062704 predicted 3144
10 SASI_Rn02_00266486 predicted 3047
11 SASI_Rn01_00062696 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080341 predicted 1321
2 SASI_Mm01_00080342 predicted 3304
3 SASI_Mm01_00080343 predicted 2070
4 SASI_Mm02_00315179 predicted 1032
5 SASI_Mm01_00080344 predicted 513
6 SASI_Mm01_00080345 predicted 1777
7 SASI_Mm01_00080346 predicted 3209
8 SASI_Mm02_00315180 predicted 762
9 SASI_Mm01_00080348 predicted 3148
10 SASI_Mm01_00080349 predicted 528
11 SASI_Mm01_00080347 predicted 292
12 SASI_Mm01_00080350 predicted 3047
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009027
RASGRF2 MISSION shRNA Bacterial Glycerol Stock
Ras protein-specific guanine nucleotide-releasing factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-939s1c1
Sequence:CCGGGCTGGCAAATTGGCCTACTTTCTCGAGAAAGTAGGCCAATTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-1811s1c1
Sequence:CCGGCCAAAGTTACTGTGCCACATACTCGAGTATGTGGCACAGTAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-1962s1c1
Sequence:CCGGGCGGTTTCTGAGCATTGATTTCTCGAGAAATCAATGCTCAGAAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-518s1c1
Sequence:CCGGCCGAAATCGAAAGGCTTAAATCTCGAGATTTAAGCCTTTCGATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-3028s1c1
Sequence:CCGGGCCTCCCAGATAATGAATTATCTCGAGATAATTCATTATCTGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009027
RASGRF2 MISSION shRNA shRNA Plasmid DNA
Ras protein-specific guanine nucleotide-releasing factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-939s1c1
Sequence:CCGGGCTGGCAAATTGGCCTACTTTCTCGAGAAAGTAGGCCAATTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-1811s1c1
Sequence:CCGGCCAAAGTTACTGTGCCACATACTCGAGTATGTGGCACAGTAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-1962s1c1
Sequence:CCGGGCGGTTTCTGAGCATTGATTTCTCGAGAAATCAATGCTCAGAAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-518s1c1
Sequence:CCGGCCGAAATCGAAAGGCTTAAATCTCGAGATTTAAGCCTTTCGATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-3028s1c1
Sequence:CCGGGCCTCCCAGATAATGAATTATCTCGAGATAATTCATTATCTGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009027
RASGRF2 MISSION shRNA Lentiviral Transduction Particles
Ras protein-specific guanine nucleotide-releasing factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-939s1c1
Sequence:CCGGGCTGGCAAATTGGCCTACTTTCTCGAGAAAGTAGGCCAATTTGCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-1811s1c1
Sequence:CCGGCCAAAGTTACTGTGCCACATACTCGAGTATGTGGCACAGTAACTTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-1962s1c1
Sequence:CCGGGCGGTTTCTGAGCATTGATTTCTCGAGAAATCAATGCTCAGAAACCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-518s1c1
Sequence:CCGGCCGAAATCGAAAGGCTTAAATCTCGAGATTTAAGCCTTTCGATTTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000077597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009027.2-3028s1c1
Sequence:CCGGGCCTCCCAGATAATGAATTATCTCGAGATAATTCATTATCTGGGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006909
RASGRF2 MISSION shRNA Bacterial Glycerol Stock
Ras protein-specific guanine nucleotide-releasing factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006909.1-3812s1c1
Sequence:CCGGGCTCCTTTCTCCACCAAAGAACTCGAGTTCTTTGGTGGAGAAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-610s1c1
Sequence:CCGGCCAGACATCAAGAAGATTAAACTCGAGTTTAATCTTCTTGATGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-3361s1c1
Sequence:CCGGGCTCTAATGGACAAACTTCAACTCGAGTTGAAGTTTGTCCATTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-1962s1c1
Sequence:CCGGGCGGTTTCTTAGTATTGATTTCTCGAGAAATCAATACTAAGAAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-3656s21c1
Sequence:CCGGTAGATGAAGATACGCTATATGCTCGAGCATATAGCGTATCTTCATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-3209s21c1
Sequence:CCGGGTGCCAACGCCATCGAGAAATCTCGAGATTTCTCGATGGCGTTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-1759s21c1
Sequence:CCGGGTGGACAATATACGATGTAATCTCGAGATTACATCGTATATTGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-410s21c1
Sequence:CCGGTGATTGAGAGGGAAGTATTAACTCGAGTTAATACTTCCCTCTCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006909.1-3913s21c1
Sequence:CCGGGAAGGTGAAAGATGGCTATTTCTCGAGAAATAGCCATCTTTCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006909
RASGRF2 MISSION shRNA shRNA Plasmid DNA
Ras protein-specific guanine nucleotide-releasing factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006909.1-3812s1c1
Sequence:CCGGGCTCCTTTCTCCACCAAAGAACTCGAGTTCTTTGGTGGAGAAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-610s1c1
Sequence:CCGGCCAGACATCAAGAAGATTAAACTCGAGTTTAATCTTCTTGATGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-3361s1c1
Sequence:CCGGGCTCTAATGGACAAACTTCAACTCGAGTTGAAGTTTGTCCATTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-1962s1c1
Sequence:CCGGGCGGTTTCTTAGTATTGATTTCTCGAGAAATCAATACTAAGAAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-3656s21c1
Sequence:CCGGTAGATGAAGATACGCTATATGCTCGAGCATATAGCGTATCTTCATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-3209s21c1
Sequence:CCGGGTGCCAACGCCATCGAGAAATCTCGAGATTTCTCGATGGCGTTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-1759s21c1
Sequence:CCGGGTGGACAATATACGATGTAATCTCGAGATTACATCGTATATTGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-410s21c1
Sequence:CCGGTGATTGAGAGGGAAGTATTAACTCGAGTTAATACTTCCCTCTCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006909.1-3913s21c1
Sequence:CCGGGAAGGTGAAAGATGGCTATTTCTCGAGAAATAGCCATCTTTCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006909
RASGRF2 MISSION shRNA Lentiviral Transduction Particles
Ras protein-specific guanine nucleotide-releasing factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006909.1-3812s1c1
Sequence:CCGGGCTCCTTTCTCCACCAAAGAACTCGAGTTCTTTGGTGGAGAAAGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-610s1c1
Sequence:CCGGCCAGACATCAAGAAGATTAAACTCGAGTTTAATCTTCTTGATGTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-3361s1c1
Sequence:CCGGGCTCTAATGGACAAACTTCAACTCGAGTTGAAGTTTGTCCATTAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000072969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006909.1-1962s1c1
Sequence:CCGGGCGGTTTCTTAGTATTGATTTCTCGAGAAATCAATACTAAGAAACCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-3656s21c1
Sequence:CCGGTAGATGAAGATACGCTATATGCTCGAGCATATAGCGTATCTTCATCTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000435047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-3209s21c1
Sequence:CCGGGTGCCAACGCCATCGAGAAATCTCGAGATTTCTCGATGGCGTTGGCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-1759s21c1
Sequence:CCGGGTGGACAATATACGATGTAATCTCGAGATTACATCGTATATTGTCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006909.1-410s21c1
Sequence:CCGGTGATTGAGAGGGAAGTATTAACTCGAGTTAATACTTCCCTCTCAATCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006909.1-3913s21c1
Sequence:CCGGGAAGGTGAAAGATGGCTATTTCTCGAGAAATAGCCATCTTTCACCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???