EMAIL THIS PAGE TO A FRIEND

RASGRP2

RAS guanyl releasing protein 2 (calcium and DAG-regulated)

124 Gene Product Result for
Synonyms: CALDAG-GEFI CDC25L
UniProtKB ID: Q7LDG7, O00538, Q9UL65
Gene ID:
Human(10235) Summary: The protein encoded by this gene is a brain-enriched nucleotide exchanged factor that contains an N-terminal GEF domain, 2 tandem repeats of EF-hand calcium-binding motifs, and a C-terminal diacylglycerol/phorbol ester-binding domain. This protein can activate small GTPases, including RAS and RAP1/RAS3. The nucleotide exchange activity of this protein can be stimulated by calcium and diacylglycerol. Three alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(19395) RAS, guanyl releasing protein 2
Rat(361714) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
cow(512056) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
sheep(101104023) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Domestic Rabbit(100328903) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
naked mole-rat(101714183) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
domestic guinea pig(100722152) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Zebrafish(557063) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Horse(100055959) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
domestic cat(101094450) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
dog(612101) RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098670 Rosetta Predictions human pricing
NM_001098671 Rosetta Predictions human pricing
NM_005825 Rosetta Predictions human pricing
NM_153819 Rosetta Predictions human pricing
NM_001082977 Rosetta Predictions rat pricing
XM_001071741 Rosetta Predictions rat pricing
NM_011242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319691 predicted 552
2 SASI_Hs02_00319692 predicted 792
3 SASI_Hs02_00319693 predicted 870
4 SASI_Hs02_00319694 predicted 1778
5 SASI_Hs02_00319695 predicted 1533
6 SASI_Hs02_00319696 predicted 1478
7 SASI_Hs02_00319697 predicted 681
8 SASI_Hs02_00319698 predicted 616
9 SASI_Hs02_00319699 predicted 1798
10 SASI_Hs02_00319700 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319701 predicted 588
2 SASI_Hs02_00319702 predicted 832
3 SASI_Hs02_00319703 predicted 910
4 SASI_Hs02_00319704 predicted 1822
5 SASI_Hs02_00319705 predicted 1573
6 SASI_Hs02_00319706 predicted 1511
7 SASI_Hs02_00319707 predicted 717
8 SASI_Hs02_00319708 predicted 651
9 SASI_Hs02_00319709 predicted 1841
10 SASI_Hs02_00319710 predicted 2035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145089 predicted 731
2 SASI_Hs01_00145090 predicted 971
3 SASI_Hs01_00145091 predicted 1961
4 SASI_Hs01_00145092 predicted 769
5 SASI_Hs01_00145093 predicted 1458
6 SASI_Hs01_00145094 predicted 1718
7 SASI_Hs01_00145095 predicted 1651
8 SASI_Hs01_00145096 predicted 853
9 SASI_Hs01_00145097 predicted 789
10 SASI_Hs01_00145098 predicted 1975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146782 predicted 622
2 SASI_Hs01_00146783 predicted 858
3 SASI_Hs02_00367498 predicted 941
4 SASI_Hs01_00146784 predicted 1841
5 SASI_Hs01_00146787 predicted 1600
6 SASI_Hs01_00146788 predicted 1540
7 SASI_Hs01_00146789 predicted 739
8 SASI_Hs01_00146790 predicted 676
9 SASI_Hs01_00146791 predicted 1870
10 SASI_Hs02_00367499 predicted 2059
11 SASI_Hs01_00146785 predicted 658
12 SASI_Hs01_00146786 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208819 predicted 676
2 SASI_Rn02_00208820 predicted 739
3 SASI_Rn02_00208821 predicted 632
4 SASI_Rn02_00208822 predicted 592
5 SASI_Rn02_00208823 predicted 710
6 SASI_Rn02_00208824 predicted 1756
7 SASI_Rn02_00208825 predicted 363
8 SASI_Rn02_00208826 predicted 267
9 SASI_Rn02_00208827 predicted 657
10 SASI_Rn02_00208828 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336286 predicted 667
2 SASI_Rn02_00336287 predicted 744
3 SASI_Rn02_00336288 predicted 631
4 SASI_Rn02_00336289 predicted 587
5 SASI_Rn02_00336290 predicted 708
6 SASI_Rn02_00336291 predicted 1761
7 SASI_Rn02_00336292 predicted 358
8 SASI_Rn02_00336293 predicted 273
9 SASI_Rn02_00336294 predicted 653
10 SASI_Rn02_00336295 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320223 predicted 649
2 SASI_Mm02_00320224 predicted 333
3 SASI_Mm01_00062613 predicted 1734
4 SASI_Mm02_00320225 predicted 205
5 SASI_Mm02_00320226 predicted 562
6 SASI_Mm02_00320227 predicted 628
7 SASI_Mm02_00320228 predicted 562
8 SASI_Mm01_00062618 predicted 1436
9 SASI_Mm02_00320229 predicted 1971
10 SASI_Mm02_00320230 predicted 1460
11 SASI_Mm01_00062609 predicted 672
12 SASI_Mm01_00062610 predicted 636
13 SASI_Mm01_00062611 predicted 593
14 SASI_Mm01_00062612 predicted 715
15 SASI_Mm01_00062614 predicted 371
16 SASI_Mm01_00062615 predicted 1983
17 SASI_Mm01_00062616 predicted 659
18 SASI_Mm01_00062617 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011242
RASGRP2 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011242.1-1998s1c1
Sequence:CCGGTGTGACTATCAAGGACTCATTCTCGAGAATGAGTCCTTGATAGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-759s1c1
Sequence:CCGGCCTCTTCAACAGTGTCTCTCACTCGAGTGAGAGACACTGTTGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-217s1c1
Sequence:CCGGCGTGGCTGTATCGAAGCCTTTCTCGAGAAAGGCTTCGATACAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-628s1c1
Sequence:CCGGCCTATGGAACTGGCAGAACATCTCGAGATGTTCTGCCAGTTCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-1739s1c1
Sequence:CCGGAGGGCCTCAAATGTAGAGCTTCTCGAGAAGCTCTACATTTGAGGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011242
RASGRP2 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011242.1-1998s1c1
Sequence:CCGGTGTGACTATCAAGGACTCATTCTCGAGAATGAGTCCTTGATAGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-759s1c1
Sequence:CCGGCCTCTTCAACAGTGTCTCTCACTCGAGTGAGAGACACTGTTGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-217s1c1
Sequence:CCGGCGTGGCTGTATCGAAGCCTTTCTCGAGAAAGGCTTCGATACAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-628s1c1
Sequence:CCGGCCTATGGAACTGGCAGAACATCTCGAGATGTTCTGCCAGTTCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-1739s1c1
Sequence:CCGGAGGGCCTCAAATGTAGAGCTTCTCGAGAAGCTCTACATTTGAGGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011242
RASGRP2 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011242.1-1998s1c1
Sequence:CCGGTGTGACTATCAAGGACTCATTCTCGAGAATGAGTCCTTGATAGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-759s1c1
Sequence:CCGGCCTCTTCAACAGTGTCTCTCACTCGAGTGAGAGACACTGTTGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-217s1c1
Sequence:CCGGCGTGGCTGTATCGAAGCCTTTCTCGAGAAAGGCTTCGATACAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-628s1c1
Sequence:CCGGCCTATGGAACTGGCAGAACATCTCGAGATGTTCTGCCAGTTCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011242.1-1739s1c1
Sequence:CCGGAGGGCCTCAAATGTAGAGCTTCTCGAGAAGCTCTACATTTGAGGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005825
RASGRP2 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-789s1c1
Sequence:CCGGCGCAAGATGTCCCTGTTGTTTCTCGAGAAACAACAGGGACATCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-1205s1c1
Sequence:CCGGGACAGGCAACTATGGCAACTACTCGAGTAGTTGCCATAGTTGCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-525s1c1
Sequence:CCGGCTGCTCCACATCTACCAACAACTCGAGTTGTTGGTAGATGTGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-626s1c1
Sequence:CCGGGTTTGACTTGAACCCGGAGTTCTCGAGAACTCCGGGTTCAAGTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-1464s1c1
Sequence:CCGGGATCAGTATCAGACGGAGGATCTCGAGATCCTCCGTCTGATACTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005825
RASGRP2 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-789s1c1
Sequence:CCGGCGCAAGATGTCCCTGTTGTTTCTCGAGAAACAACAGGGACATCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-1205s1c1
Sequence:CCGGGACAGGCAACTATGGCAACTACTCGAGTAGTTGCCATAGTTGCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-525s1c1
Sequence:CCGGCTGCTCCACATCTACCAACAACTCGAGTTGTTGGTAGATGTGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-626s1c1
Sequence:CCGGGTTTGACTTGAACCCGGAGTTCTCGAGAACTCCGGGTTCAAGTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-1464s1c1
Sequence:CCGGGATCAGTATCAGACGGAGGATCTCGAGATCCTCCGTCTGATACTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005825
RASGRP2 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 2 (calcium and DAG-regulated)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-789s1c1
Sequence:CCGGCGCAAGATGTCCCTGTTGTTTCTCGAGAAACAACAGGGACATCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-1205s1c1
Sequence:CCGGGACAGGCAACTATGGCAACTACTCGAGTAGTTGCCATAGTTGCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-525s1c1
Sequence:CCGGCTGCTCCACATCTACCAACAACTCGAGTTGTTGGTAGATGTGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-626s1c1
Sequence:CCGGGTTTGACTTGAACCCGGAGTTCTCGAGAACTCCGGGTTCAAGTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005825.2-1464s1c1
Sequence:CCGGGATCAGTATCAGACGGAGGATCTCGAGATCCTCCGTCTGATACTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)