EMAIL THIS PAGE TO A FRIEND

RASGRP3

RAS guanyl releasing protein 3 (calcium and DAG-regulated)

141 Gene Product Result for
Synonyms: GRP3
UniProtKB ID: Q8IV61, D6W583, O94931, Q53SD7
Gene ID:
Human(25780) Summary: Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]
Mouse(240168) RAS, guanyl releasing protein 3
Rat(313874) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Zebrafish(563441) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
chicken(421460) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Horse(100070505) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
dog(611329) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
domestic guinea pig(100712845) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
naked mole-rat(101717811) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Domestic Rabbit(100342183) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
cow(523745) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
sheep(101101969) RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170672 Rosetta Predictions human pricing
NM_001108009 Rosetta Predictions rat pricing
NM_207246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178008 predicted 2059
2 SASI_Hs01_00178009 predicted 1140
3 SASI_Hs01_00178010 predicted 1731
4 SASI_Hs01_00178011 predicted 1887
5 SASI_Hs02_00367575 predicted 1268
6 SASI_Hs01_00178013 predicted 943
7 SASI_Hs01_00178014 predicted 924
8 SASI_Hs01_00178015 predicted 1193
9 SASI_Hs01_00178016 predicted 2404
10 SASI_Hs02_00367576 predicted 893
11 SASI_Hs01_00178007 predicted 823
12 SASI_Hs01_00178012 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234465 predicted 996
2 SASI_Rn02_00234466 predicted 1478
3 SASI_Rn02_00234467 predicted 472
4 SASI_Rn02_00234468 predicted 1419
5 SASI_Rn02_00234469 predicted 617
6 SASI_Rn02_00234470 predicted 825
7 SASI_Rn02_00234471 predicted 924
8 SASI_Rn02_00234472 predicted 1835
9 SASI_Rn02_00234473 predicted 498
10 SASI_Rn02_00234474 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051043 predicted 372
2 SASI_Mm01_00051044 predicted 828
3 SASI_Mm01_00051045 predicted 928
4 SASI_Mm01_00051046 predicted 1691
5 SASI_Mm01_00051047 predicted 2430
6 SASI_Mm01_00051048 predicted 2412
7 SASI_Mm02_00351987 predicted 630
8 SASI_Mm01_00051051 predicted 1553
9 SASI_Mm01_00051052 predicted 2089
10 SASI_Mm02_00351988 predicted 442
11 SASI_Mm01_00051049 predicted 1129
12 SASI_Mm01_00051050 predicted 974
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170672
RASGRP3 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-824s1c1
Sequence:CCGGGCTGCAATGAATTTCGATTAACTCGAGTTAATCGAAATTCATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-943s1c1
Sequence:CCGGGCTAGTCAACTAGGATATGAACTCGAGTTCATATCCTAGTTGACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1466s1c1
Sequence:CCGGCCAACGGCAATTACTGCAATTCTCGAGAATTGCAGTAATTGCCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1871s1c1
Sequence:CCGGCGGTCATCAACAAGCACATAACTCGAGTTATGTGCTTGTTGATGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1367s1c1
Sequence:CCGGGCCTCAGTCATAGTTCCATTTCTCGAGAAATGGAACTATGACTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-2016s21c1
Sequence:CCGGAGATCAGGATGGCCTAATTAGCTCGAGCTAATTAGGCCATCCTGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-968s21c1
Sequence:CCGGACGTCAGCCTCATCGACATATCTCGAGATATGTCGATGAGGCTGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170672.2-2869s21c1
Sequence:CCGGGACCCTAACTAACTAACTATGCTCGAGCATAGTTAGTTAGTTAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-2149s21c1
Sequence:CCGGTGCGAACACTGTGCGGGATTTCTCGAGAAATCCCGCACAGTGTTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170672
RASGRP3 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-824s1c1
Sequence:CCGGGCTGCAATGAATTTCGATTAACTCGAGTTAATCGAAATTCATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-943s1c1
Sequence:CCGGGCTAGTCAACTAGGATATGAACTCGAGTTCATATCCTAGTTGACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1466s1c1
Sequence:CCGGCCAACGGCAATTACTGCAATTCTCGAGAATTGCAGTAATTGCCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1871s1c1
Sequence:CCGGCGGTCATCAACAAGCACATAACTCGAGTTATGTGCTTGTTGATGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1367s1c1
Sequence:CCGGGCCTCAGTCATAGTTCCATTTCTCGAGAAATGGAACTATGACTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-2016s21c1
Sequence:CCGGAGATCAGGATGGCCTAATTAGCTCGAGCTAATTAGGCCATCCTGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-968s21c1
Sequence:CCGGACGTCAGCCTCATCGACATATCTCGAGATATGTCGATGAGGCTGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170672.2-2869s21c1
Sequence:CCGGGACCCTAACTAACTAACTATGCTCGAGCATAGTTAGTTAGTTAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-2149s21c1
Sequence:CCGGTGCGAACACTGTGCGGGATTTCTCGAGAAATCCCGCACAGTGTTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170672
RASGRP3 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-824s1c1
Sequence:CCGGGCTGCAATGAATTTCGATTAACTCGAGTTAATCGAAATTCATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-943s1c1
Sequence:CCGGGCTAGTCAACTAGGATATGAACTCGAGTTCATATCCTAGTTGACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1466s1c1
Sequence:CCGGCCAACGGCAATTACTGCAATTCTCGAGAATTGCAGTAATTGCCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1871s1c1
Sequence:CCGGCGGTCATCAACAAGCACATAACTCGAGTTATGTGCTTGTTGATGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170672.1-1367s1c1
Sequence:CCGGGCCTCAGTCATAGTTCCATTTCTCGAGAAATGGAACTATGACTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-2016s21c1
Sequence:CCGGAGATCAGGATGGCCTAATTAGCTCGAGCTAATTAGGCCATCCTGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-968s21c1
Sequence:CCGGACGTCAGCCTCATCGACATATCTCGAGATATGTCGATGAGGCTGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170672.2-2869s21c1
Sequence:CCGGGACCCTAACTAACTAACTATGCTCGAGCATAGTTAGTTAGTTAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170672.2-2149s21c1
Sequence:CCGGTGCGAACACTGTGCGGGATTTCTCGAGAAATCCCGCACAGTGTTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207246
VALIDATED
RASGRP3 MISSION shRNA Bacterial Glycerol Stock
RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-573s1c1
Sequence:CCGGGCAGAGTTTAATTTGGATCTTCTCGAGAAGATCCAAATTAAACTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207246.2-744s1c1
Sequence:CCGGGCCTGCCTCTTATTTGACCATCTCGAGATGGTCAAATAAGAGGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207246.2-2298s1c1
Sequence:CCGGGCTGGTGTGGATGTTGTAGATCTCGAGATCTACAACATCCACACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-1740s1c1
Sequence:CCGGGCTTATTTCCTGAGAGCTAAACTCGAGTTTAGCTCTCAGGAAATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-1153s1c1
Sequence:CCGGCCAATGGCAATTACTGCAATTCTCGAGAATTGCAGTAATTGCCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-1836s21c1
Sequence:CCGGTGCGAACACTGTGCGGGATTTCTCGAGAAATCCCGCACAGTGTTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-432s21c1
Sequence:CCGGCTGATGCACCGATGGTATTTACTCGAGTAAATACCATCGGTGCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-1703s21c1
Sequence:CCGGAGATCAGGACGGCCTAATTAGCTCGAGCTAATTAGGCCGTCCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207246
VALIDATED
RASGRP3 MISSION shRNA shRNA Plasmid DNA
RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-573s1c1
Sequence:CCGGGCAGAGTTTAATTTGGATCTTCTCGAGAAGATCCAAATTAAACTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207246.2-744s1c1
Sequence:CCGGGCCTGCCTCTTATTTGACCATCTCGAGATGGTCAAATAAGAGGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207246.2-2298s1c1
Sequence:CCGGGCTGGTGTGGATGTTGTAGATCTCGAGATCTACAACATCCACACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-1740s1c1
Sequence:CCGGGCTTATTTCCTGAGAGCTAAACTCGAGTTTAGCTCTCAGGAAATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-1153s1c1
Sequence:CCGGCCAATGGCAATTACTGCAATTCTCGAGAATTGCAGTAATTGCCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-1836s21c1
Sequence:CCGGTGCGAACACTGTGCGGGATTTCTCGAGAAATCCCGCACAGTGTTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-432s21c1
Sequence:CCGGCTGATGCACCGATGGTATTTACTCGAGTAAATACCATCGGTGCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-1703s21c1
Sequence:CCGGAGATCAGGACGGCCTAATTAGCTCGAGCTAATTAGGCCGTCCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207246
VALIDATED
RASGRP3 MISSION shRNA Lentiviral Transduction Particles
RAS guanyl releasing protein 3 (calcium and DAG-regulated)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-573s1c1
Sequence:CCGGGCAGAGTTTAATTTGGATCTTCTCGAGAAGATCCAAATTAAACTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207246.2-744s1c1
Sequence:CCGGGCCTGCCTCTTATTTGACCATCTCGAGATGGTCAAATAAGAGGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207246.2-2298s1c1
Sequence:CCGGGCTGGTGTGGATGTTGTAGATCTCGAGATCTACAACATCCACACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-1740s1c1
Sequence:CCGGGCTTATTTCCTGAGAGCTAAACTCGAGTTTAGCTCTCAGGAAATAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207246.2-1153s1c1
Sequence:CCGGCCAATGGCAATTACTGCAATTCTCGAGAATTGCAGTAATTGCCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-1836s21c1
Sequence:CCGGTGCGAACACTGTGCGGGATTTCTCGAGAAATCCCGCACAGTGTTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-432s21c1
Sequence:CCGGCTGATGCACCGATGGTATTTACTCGAGTAAATACCATCGGTGCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207246.3-1703s21c1
Sequence:CCGGAGATCAGGACGGCCTAATTAGCTCGAGCTAATTAGGCCGTCCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)