EMAIL THIS PAGE TO A FRIEND

RASL10A

RAS-like, family 10, member A

82 Gene Product Result for
Synonyms: RRP22
UniProtKB ID: Q92737, Q49AU5, Q6PI03
Gene ID:
Mouse(75668) RAS-like, family 10, member A
Rat(364190) RAS-like, family 10, member A
cow(506193) RAS-like, family 10, member A
sheep(101121457) RAS-like, family 10, member A
naked mole-rat(101701455) RAS-like, family 10, member A
domestic guinea pig(100717699) RAS-like, family 10, member A
Zebrafish(100004647) RAS-like, family 10, member A
domestic cat(101093648) RAS-like, family 10, member A
dog(486343) RAS-like, family 10, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006477 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073181 MISSION® esiRNA esiRNA targeting mouse Rasl10a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007279 Rosetta Predictions human pricing
NM_006477 Rosetta Predictions human pricing
NM_001108862 Rosetta Predictions rat pricing
NM_145216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160374 predicted 775
2 SASI_Hs01_00160375 predicted 662
3 SASI_Hs01_00160376 predicted 569
4 SASI_Hs01_00160377 predicted 1059
5 SASI_Hs01_00160378 predicted 1170
6 SASI_Hs02_00305304 predicted 930
7 SASI_Hs01_00160379 predicted 1744
8 SASI_Hs01_00160380 predicted 1683
9 SASI_Hs01_00160381 predicted 1641
10 SASI_Hs01_00160382 predicted 1411
11 SASI_Hs01_00160373 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059148 predicted 1219
2 SASI_Hs02_00341660 predicted 1224
3 SASI_Hs01_00059149 predicted 1174
4 SASI_Hs02_00341661 predicted 1245
5 SASI_Hs01_00059151 predicted 1097
6 SASI_Hs01_00059152 predicted 1173
7 SASI_Hs01_00059153 predicted 1255
8 SASI_Hs01_00059154 predicted 1114
9 SASI_Hs01_00059155 predicted 1124
10 SASI_Hs01_00059156 predicted 1183
11 SASI_Hs01_00059150 predicted 1155
12 SASI_Hs01_00059157 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242815 predicted 212
2 SASI_Rn02_00242816 predicted 296
3 SASI_Rn02_00242817 predicted 557
4 SASI_Rn02_00242818 predicted 354
5 SASI_Rn02_00242819 predicted 212
6 SASI_Rn02_00242820 predicted 279
7 SASI_Rn02_00242821 predicted 445
8 SASI_Rn02_00242822 predicted 237
9 SASI_Rn02_00242823 predicted 202
10 SASI_Rn02_00242824 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113888 predicted 239
2 SASI_Mm02_00340590 predicted 406
3 SASI_Mm01_00113889 predicted 244
4 SASI_Mm01_00113890 predicted 867
5 SASI_Mm01_00113891 predicted 322
6 SASI_Mm01_00113892 predicted 227
7 SASI_Mm01_00113893 predicted 224
8 SASI_Mm01_00113894 predicted 643
9 SASI_Mm01_00113895 predicted 431
10 SASI_Mm01_00113896 predicted 861
11 SASI_Mm01_00113897 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006477
RASL10A MISSION shRNA Bacterial Glycerol Stock
RAS-like, family 10, member A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1347s21c1
Sequence:CCGGTGGGACCTCAATGGGTCACAACTCGAGTTGTGACCCATTGAGGTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-1120s21c1
Sequence:CCGGATGTGACCCGATCGGACAGTGCTCGAGCACTGTCCGATCGGGTCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-985s21c1
Sequence:CCGGGAGTGCTCCGCCAAGTACAACCTCGAGGTTGTACTTGGCGGAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1291s21c1
Sequence:CCGGGAACCTCATTGGACCCAACCACTCGAGTGGTTGGGTCCAATGAGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-664s21c1
Sequence:CCGGGCCGTCTACGACTTGAGCATCCTCGAGGATGCTCAAGTCGTAGACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-883s21c1
Sequence:CCGGATCCTCGTGGTAGGCAACAAGCTCGAGCTTGTTGCCTACCACGAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1156s21c1
Sequence:CCGGACCTTGTGACTGGGACAATCACTCGAGTGATTGTCCCAGTCACAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-710s1c1
Sequence:CCGGCCCGGACAGTTTCGACTACGTCTCGAGACGTAGTCGAAACTGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-470s1c1
Sequence:CCGGGACGGCCATCATCCGCCAGTTCTCGAGAACTGGCGGATGATGGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-650s1c1
Sequence:CCGGCGCTAAGGACTGGAGCTTGCACTCGAGTGCAAGCTCCAGTCCTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-920s1c1
Sequence:CCGGGCTGCGTCTCTTCCGCGAGCTCTCGAGAGCTCGCGGAAGAGACGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006477
RASL10A MISSION shRNA shRNA Plasmid DNA
RAS-like, family 10, member A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1347s21c1
Sequence:CCGGTGGGACCTCAATGGGTCACAACTCGAGTTGTGACCCATTGAGGTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-1120s21c1
Sequence:CCGGATGTGACCCGATCGGACAGTGCTCGAGCACTGTCCGATCGGGTCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-985s21c1
Sequence:CCGGGAGTGCTCCGCCAAGTACAACCTCGAGGTTGTACTTGGCGGAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1291s21c1
Sequence:CCGGGAACCTCATTGGACCCAACCACTCGAGTGGTTGGGTCCAATGAGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-664s21c1
Sequence:CCGGGCCGTCTACGACTTGAGCATCCTCGAGGATGCTCAAGTCGTAGACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-883s21c1
Sequence:CCGGATCCTCGTGGTAGGCAACAAGCTCGAGCTTGTTGCCTACCACGAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1156s21c1
Sequence:CCGGACCTTGTGACTGGGACAATCACTCGAGTGATTGTCCCAGTCACAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-710s1c1
Sequence:CCGGCCCGGACAGTTTCGACTACGTCTCGAGACGTAGTCGAAACTGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-470s1c1
Sequence:CCGGGACGGCCATCATCCGCCAGTTCTCGAGAACTGGCGGATGATGGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-650s1c1
Sequence:CCGGCGCTAAGGACTGGAGCTTGCACTCGAGTGCAAGCTCCAGTCCTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-920s1c1
Sequence:CCGGGCTGCGTCTCTTCCGCGAGCTCTCGAGAGCTCGCGGAAGAGACGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006477
RASL10A MISSION shRNA Lentiviral Transduction Particles
RAS-like, family 10, member A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1347s21c1
Sequence:CCGGTGGGACCTCAATGGGTCACAACTCGAGTTGTGACCCATTGAGGTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-1120s21c1
Sequence:CCGGATGTGACCCGATCGGACAGTGCTCGAGCACTGTCCGATCGGGTCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-985s21c1
Sequence:CCGGGAGTGCTCCGCCAAGTACAACCTCGAGGTTGTACTTGGCGGAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1291s21c1
Sequence:CCGGGAACCTCATTGGACCCAACCACTCGAGTGGTTGGGTCCAATGAGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-664s21c1
Sequence:CCGGGCCGTCTACGACTTGAGCATCCTCGAGGATGCTCAAGTCGTAGACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006477.3-883s21c1
Sequence:CCGGATCCTCGTGGTAGGCAACAAGCTCGAGCTTGTTGCCTACCACGAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427969    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006477.3-1156s21c1
Sequence:CCGGACCTTGTGACTGGGACAATCACTCGAGTGATTGTCCCAGTCACAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-710s1c1
Sequence:CCGGCCCGGACAGTTTCGACTACGTCTCGAGACGTAGTCGAAACTGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-470s1c1
Sequence:CCGGGACGGCCATCATCCGCCAGTTCTCGAGAACTGGCGGATGATGGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-650s1c1
Sequence:CCGGCGCTAAGGACTGGAGCTTGCACTCGAGTGCAAGCTCCAGTCCTTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006477.2-920s1c1
Sequence:CCGGGCTGCGTCTCTTCCGCGAGCTCTCGAGAGCTCGCGGAAGAGACGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145216
RASL10A MISSION shRNA Bacterial Glycerol Stock
RAS-like, family 10, member A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145216.3-937s21c1
Sequence:CCGGGAAAGGACTTGACTATGAATGCTCGAGCATTCATAGTCAAGTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145216.3-497s21c1
Sequence:CCGGCTGAGGCAGCGTATAGCAGAACTCGAGTTCTGCTATACGCTGCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145216.3-695s21c1
Sequence:CCGGGAGCTTCTGCGTTGTGCTTTGCTCGAGCAAAGCACAACGCAGAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145216.3-907s21c1
Sequence:CCGGTGAGACCTTATTGGGTCATAACTCGAGTTATGACCCAATAAGGTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-471s1c1
Sequence:CCGGCCCGACAGTTTCGATTATGTTCTCGAGAACATAATCGAAACTGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-245s1c1
Sequence:CCGGCCAATTCTTGTTTGGTGACTACTCGAGTAGTCACCAAACAAGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-233s1c1
Sequence:CCGGCGCCATCATCCGCCAATTCTTCTCGAGAAGAATTGGCGGATGATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145216.2-869s1c1
Sequence:CCGGCCCAGCTAACTCCCAATCATTCTCGAGAATGATTGGGAGTTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-650s1c1
Sequence:CCGGCGAGTGCTCAGCCAAATACAACTCGAGTTGTATTTGGCTGAGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145216
RASL10A MISSION shRNA shRNA Plasmid DNA
RAS-like, family 10, member A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145216.3-937s21c1
Sequence:CCGGGAAAGGACTTGACTATGAATGCTCGAGCATTCATAGTCAAGTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145216.3-497s21c1
Sequence:CCGGCTGAGGCAGCGTATAGCAGAACTCGAGTTCTGCTATACGCTGCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145216.3-695s21c1
Sequence:CCGGGAGCTTCTGCGTTGTGCTTTGCTCGAGCAAAGCACAACGCAGAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145216.3-907s21c1
Sequence:CCGGTGAGACCTTATTGGGTCATAACTCGAGTTATGACCCAATAAGGTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-471s1c1
Sequence:CCGGCCCGACAGTTTCGATTATGTTCTCGAGAACATAATCGAAACTGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-245s1c1
Sequence:CCGGCCAATTCTTGTTTGGTGACTACTCGAGTAGTCACCAAACAAGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-233s1c1
Sequence:CCGGCGCCATCATCCGCCAATTCTTCTCGAGAAGAATTGGCGGATGATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145216.2-869s1c1
Sequence:CCGGCCCAGCTAACTCCCAATCATTCTCGAGAATGATTGGGAGTTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-650s1c1
Sequence:CCGGCGAGTGCTCAGCCAAATACAACTCGAGTTGTATTTGGCTGAGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145216
RASL10A MISSION shRNA Lentiviral Transduction Particles
RAS-like, family 10, member A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145216.3-937s21c1
Sequence:CCGGGAAAGGACTTGACTATGAATGCTCGAGCATTCATAGTCAAGTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145216.3-497s21c1
Sequence:CCGGCTGAGGCAGCGTATAGCAGAACTCGAGTTCTGCTATACGCTGCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145216.3-695s21c1
Sequence:CCGGGAGCTTCTGCGTTGTGCTTTGCTCGAGCAAAGCACAACGCAGAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145216.3-907s21c1
Sequence:CCGGTGAGACCTTATTGGGTCATAACTCGAGTTATGACCCAATAAGGTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-471s1c1
Sequence:CCGGCCCGACAGTTTCGATTATGTTCTCGAGAACATAATCGAAACTGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-245s1c1
Sequence:CCGGCCAATTCTTGTTTGGTGACTACTCGAGTAGTCACCAAACAAGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-233s1c1
Sequence:CCGGCGCCATCATCCGCCAATTCTTCTCGAGAAGAATTGGCGGATGATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102670    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145216.2-869s1c1
Sequence:CCGGCCCAGCTAACTCCCAATCATTCTCGAGAATGATTGGGAGTTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145216.2-650s1c1
Sequence:CCGGCGAGTGCTCAGCCAAATACAACTCGAGTTGTATTTGGCTGAGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)