EMAIL THIS PAGE TO A FRIEND

RASL10B

RAS-like, family 10, member B

165 Gene Product Result for
Synonyms: RRP17 VTS58635
UniProtKB ID: Q96S79, B3KV31
Gene ID:
Mouse(276952) RAS-like, family 10, member B
Rat(303382) RAS-like, family 10, member B
chicken(771592) RAS-like, family 10, member B
domestic cat(101080589) RAS-like, family 10, member B
dog(491138) RAS-like, family 10, member B
domestic guinea pig(100713283) RAS-like, family 10, member B
naked mole-rat(101710334) RAS-like, family 10, member B
cow(522270) RAS-like, family 10, member B
sheep(101112833) RAS-like, family 10, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033315 Rosetta Predictions human pricing
XM_001081057 Rosetta Predictions rat pricing
XM_220782 Rosetta Predictions rat pricing
NM_001013386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024678 predicted 539
2 SASI_Hs01_00024679 predicted 349
3 SASI_Hs01_00024680 predicted 1239
4 SASI_Hs01_00024681 predicted 573
5 SASI_Hs01_00024682 predicted 397
6 SASI_Hs01_00024683 predicted 330
7 SASI_Hs01_00024684 predicted 624
8 SASI_Hs01_00024685 predicted 563
9 SASI_Hs01_00024686 predicted 611
10 SASI_Hs02_00361163 predicted 634
11 SASI_Hs01_00024677 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370384 predicted 941
2 SASI_Rn02_00370385 predicted 770
3 SASI_Rn02_00370386 predicted 1651
4 SASI_Rn02_00370387 predicted 701
5 SASI_Rn02_00370388 predicted 1125
6 SASI_Rn02_00370389 predicted 717
7 SASI_Rn02_00370390 predicted 949
8 SASI_Rn02_00370391 predicted 1697
9 SASI_Rn02_00370392 predicted 1031
10 SASI_Rn02_00370393 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379534 predicted 611
2 SASI_Rn02_00379535 predicted 442
3 SASI_Rn02_00379536 predicted 1323
4 SASI_Rn02_00379537 predicted 374
5 SASI_Rn02_00379538 predicted 788
6 SASI_Rn02_00379539 predicted 387
7 SASI_Rn02_00379540 predicted 614
8 SASI_Rn02_00379541 predicted 1364
9 SASI_Rn02_00379542 predicted 700
10 SASI_Rn02_00379543 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130691 predicted 710
2 SASI_Mm01_00130692 predicted 944
3 SASI_Mm01_00130693 predicted 1710
4 SASI_Mm01_00130694 predicted 709
5 SASI_Mm01_00130696 predicted 1002
6 SASI_Mm01_00130697 predicted 1127
7 SASI_Mm01_00130698 predicted 864
8 SASI_Mm01_00130700 predicted 1492
9 SASI_Mm02_00287216 predicted 1035
10 SASI_Mm02_00287217 predicted 1051
11 SASI_Mm01_00130695 predicted 1704
12 SASI_Mm01_00130699 predicted 1688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033315
VALIDATED
RASL10B MISSION shRNA Bacterial Glycerol Stock
RAS-like, family 10, member B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-752s1c1
Sequence:CCGGCGTGGAATGCTCGGCCAAGTACTCGAGTACTTGGCCGAGCATTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-584s1c1
Sequence:CCGGCTTTGAGTACGTCAAGACCATCTCGAGATGGTCTTGACGTACTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-446s1c1
Sequence:CCGGCGACCTCCAGATCCTCGACTTCTCGAGAAGTCGAGGATCTGGAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-353s1c1
Sequence:CCGGCCAGTTCTTGTACAACGAGTTCTCGAGAACTCGTTGTACAAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-572s1c1
Sequence:CCGGCTGCTTTGACAGCTTTGAGTACTCGAGTACTCAAAGCTGTCAAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033315
VALIDATED
RASL10B MISSION shRNA shRNA Plasmid DNA
RAS-like, family 10, member B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-752s1c1
Sequence:CCGGCGTGGAATGCTCGGCCAAGTACTCGAGTACTTGGCCGAGCATTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-584s1c1
Sequence:CCGGCTTTGAGTACGTCAAGACCATCTCGAGATGGTCTTGACGTACTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-446s1c1
Sequence:CCGGCGACCTCCAGATCCTCGACTTCTCGAGAAGTCGAGGATCTGGAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-353s1c1
Sequence:CCGGCCAGTTCTTGTACAACGAGTTCTCGAGAACTCGTTGTACAAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-572s1c1
Sequence:CCGGCTGCTTTGACAGCTTTGAGTACTCGAGTACTCAAAGCTGTCAAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033315
VALIDATED
RASL10B MISSION shRNA Lentiviral Transduction Particles
RAS-like, family 10, member B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-752s1c1
Sequence:CCGGCGTGGAATGCTCGGCCAAGTACTCGAGTACTTGGCCGAGCATTCCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-584s1c1
Sequence:CCGGCTTTGAGTACGTCAAGACCATCTCGAGATGGTCTTGACGTACTCAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-446s1c1
Sequence:CCGGCGACCTCCAGATCCTCGACTTCTCGAGAAGTCGAGGATCTGGAGGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-353s1c1
Sequence:CCGGCCAGTTCTTGTACAACGAGTTCTCGAGAACTCGTTGTACAAGAACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033315.2-572s1c1
Sequence:CCGGCTGCTTTGACAGCTTTGAGTACTCGAGTACTCAAAGCTGTCAAAGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013386
RASL10B MISSION shRNA Bacterial Glycerol Stock
RAS-like, family 10, member B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013386.1-1624s1c1
Sequence:CCGGCCCATCTTCTCCACAGTGTATCTCGAGATACACTGTGGAGAAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-958s1c1
Sequence:CCGGGCTTTGAGTACGTCAAGACTACTCGAGTAGTCTTGACGTACTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-718s1c1
Sequence:CCGGCCATCGTGCGCCAATTCTTATCTCGAGATAAGAATTGGCGCACGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-971s1c1
Sequence:CCGGCAAGACTATCCGTCAGCAGATCTCGAGATCTGCTGACGGATAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-933s1c1
Sequence:CCGGGTCTATGACATCTGCTGCTTTCTCGAGAAAGCAGCAGATGTCATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013386
RASL10B MISSION shRNA shRNA Plasmid DNA
RAS-like, family 10, member B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013386.1-1624s1c1
Sequence:CCGGCCCATCTTCTCCACAGTGTATCTCGAGATACACTGTGGAGAAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-958s1c1
Sequence:CCGGGCTTTGAGTACGTCAAGACTACTCGAGTAGTCTTGACGTACTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-718s1c1
Sequence:CCGGCCATCGTGCGCCAATTCTTATCTCGAGATAAGAATTGGCGCACGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-971s1c1
Sequence:CCGGCAAGACTATCCGTCAGCAGATCTCGAGATCTGCTGACGGATAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-933s1c1
Sequence:CCGGGTCTATGACATCTGCTGCTTTCTCGAGAAAGCAGCAGATGTCATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013386
RASL10B MISSION shRNA Lentiviral Transduction Particles
RAS-like, family 10, member B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013386.1-1624s1c1
Sequence:CCGGCCCATCTTCTCCACAGTGTATCTCGAGATACACTGTGGAGAAGATGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-958s1c1
Sequence:CCGGGCTTTGAGTACGTCAAGACTACTCGAGTAGTCTTGACGTACTCAAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-718s1c1
Sequence:CCGGCCATCGTGCGCCAATTCTTATCTCGAGATAAGAATTGGCGCACGATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000189494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-971s1c1
Sequence:CCGGCAAGACTATCCGTCAGCAGATCTCGAGATCTGCTGACGGATAGTCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013386.1-933s1c1
Sequence:CCGGGTCTATGACATCTGCTGCTTTCTCGAGAAAGCAGCAGATGTCATAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???