EMAIL THIS PAGE TO A FRIEND

RASSF10

Ras association (RalGDS/AF-6) domain family (N-terminal) member 10

39 Gene Product Result for
UniProtKB ID: A6NK89
Gene ID:
Mouse(78748) Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
dog(485396) Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
domestic cat(101094130) Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
naked mole-rat(101717314) Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
domestic guinea pig(100736098) Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
cow(514824) Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
sheep(101121799) Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080521 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080521 Rosetta Predictions human pricing
XM_928030 Rosetta Predictions human pricing
NM_175279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315647 predicted 1494
2 SASI_Hs02_00315648 predicted 1576
3 SASI_Hs02_00315649 predicted 411
4 SASI_Hs02_00315650 predicted 1491
5 SASI_Hs02_00315651 predicted 402
6 SASI_Hs02_00315652 predicted 309
7 SASI_Hs02_00315653 predicted 1504
8 SASI_Hs02_00315654 predicted 1606
9 SASI_Hs02_00315655 predicted 1593
10 SASI_Hs02_00315656 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259776 predicted 1319
2 SASI_Hs01_00259777 predicted 1403
3 SASI_Hs01_00259778 predicted 231
4 SASI_Hs01_00259779 predicted 1326
5 SASI_Hs01_00259780 predicted 231
6 SASI_Hs01_00259781 predicted 1427
7 SASI_Hs01_00259782 predicted 233
8 SASI_Hs01_00259783 predicted 1328
9 SASI_Hs01_00259784 predicted 233
10 SASI_Hs01_00259785 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048673 predicted 1036
2 SASI_Mm01_00048674 predicted 1075
3 SASI_Mm01_00048675 predicted 1766
4 SASI_Mm01_00048676 predicted 1733
5 SASI_Mm01_00048677 predicted 1704
6 SASI_Mm01_00048678 predicted 1748
7 SASI_Mm01_00048679 predicted 990
8 SASI_Mm01_00048680 predicted 1650
9 SASI_Mm01_00048681 predicted 234
10 SASI_Mm01_00048682 predicted 1496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080521
RASSF10 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1554s21c1
Sequence:CCGGCGTCAAGTCGGACTTGGATTACTCGAGTAATCCAAGTCCGACTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1505s21c1
Sequence:CCGGTCAGTACCAGCCTTTACATTGCTCGAGCAATGTAAAGGCTGGTACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-689s21c1
Sequence:CCGGAGAATGTGCGCTTCGTGCTAGCTCGAGCTAGCACGAAGCGCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1021s21c1
Sequence:CCGGCTTTCCCAGGACCACACAATTCTCGAGAATTGTGTGGTCCTGGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1139s21c1
Sequence:CCGGACGTGCAGGACACTTACTTGGCTCGAGCCAAGTAAGTGTCCTGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080521
RASSF10 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1554s21c1
Sequence:CCGGCGTCAAGTCGGACTTGGATTACTCGAGTAATCCAAGTCCGACTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1505s21c1
Sequence:CCGGTCAGTACCAGCCTTTACATTGCTCGAGCAATGTAAAGGCTGGTACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-689s21c1
Sequence:CCGGAGAATGTGCGCTTCGTGCTAGCTCGAGCTAGCACGAAGCGCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1021s21c1
Sequence:CCGGCTTTCCCAGGACCACACAATTCTCGAGAATTGTGTGGTCCTGGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1139s21c1
Sequence:CCGGACGTGCAGGACACTTACTTGGCTCGAGCCAAGTAAGTGTCCTGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080521
RASSF10 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1554s21c1
Sequence:CCGGCGTCAAGTCGGACTTGGATTACTCGAGTAATCCAAGTCCGACTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1505s21c1
Sequence:CCGGTCAGTACCAGCCTTTACATTGCTCGAGCAATGTAAAGGCTGGTACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-689s21c1
Sequence:CCGGAGAATGTGCGCTTCGTGCTAGCTCGAGCTAGCACGAAGCGCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1021s21c1
Sequence:CCGGCTTTCCCAGGACCACACAATTCTCGAGAATTGTGTGGTCCTGGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080521.1-1139s21c1
Sequence:CCGGACGTGCAGGACACTTACTTGGCTCGAGCCAAGTAAGTGTCCTGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175279
RASSF10 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175279.2-2654s1c1
Sequence:CCGGCCGTGATTAAACACCAGCTATCTCGAGATAGCTGGTGTTTAATCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-984s1c1
Sequence:CCGGCGCGAGATAGACCGCTACGAACTCGAGTTCGTAGCGGTCTATCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-497s1c1
Sequence:CCGGGCAGTGCTATTGCATTGTGGACTCGAGTCCACAATGCAATAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-1039s1c1
Sequence:CCGGGAGTCAACTACGTGCAGGATACTCGAGTATCCTGCACGTAGTTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-545s1c1
Sequence:CCGGGCCCAACAAGACGCGGATCTTCTCGAGAAGATCCGCGTCTTGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175279
RASSF10 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175279.2-2654s1c1
Sequence:CCGGCCGTGATTAAACACCAGCTATCTCGAGATAGCTGGTGTTTAATCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-984s1c1
Sequence:CCGGCGCGAGATAGACCGCTACGAACTCGAGTTCGTAGCGGTCTATCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-497s1c1
Sequence:CCGGGCAGTGCTATTGCATTGTGGACTCGAGTCCACAATGCAATAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-1039s1c1
Sequence:CCGGGAGTCAACTACGTGCAGGATACTCGAGTATCCTGCACGTAGTTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-545s1c1
Sequence:CCGGGCCCAACAAGACGCGGATCTTCTCGAGAAGATCCGCGTCTTGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175279
RASSF10 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family (N-terminal) member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175279.2-2654s1c1
Sequence:CCGGCCGTGATTAAACACCAGCTATCTCGAGATAGCTGGTGTTTAATCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-984s1c1
Sequence:CCGGCGCGAGATAGACCGCTACGAACTCGAGTTCGTAGCGGTCTATCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-497s1c1
Sequence:CCGGGCAGTGCTATTGCATTGTGGACTCGAGTCCACAATGCAATAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-1039s1c1
Sequence:CCGGGAGTCAACTACGTGCAGGATACTCGAGTATCCTGCACGTAGTTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175279.2-545s1c1
Sequence:CCGGGCCCAACAAGACGCGGATCTTCTCGAGAAGATCCGCGTCTTGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)