EMAIL THIS PAGE TO A FRIEND

RASSF2

Ras association (RalGDS/AF-6) domain family member 2

191 Gene Product Result for
Synonyms: CENP-34 RASFADIN
UniProtKB ID: P50749, A6NIX9, A8K5Z3, Q17S06, Q53HD0, Q6AHZ2
Gene ID:
Human(9770) Summary: This gene encodes a protein that contains a Ras association domain. Similar to its cattle and sheep counterparts, this gene is located near the prion gene. Two alternatively spliced transcripts encoding the same isoform have been reported. [provided by RefSeq, Jul 2008]
Mouse(215653) Ras association (RalGDS/AF-6) domain family member 2
Rat(311437) Ras association (RalGDS/AF-6) domain family member 2
chicken(419521) Ras association (RalGDS/AF-6) domain family member 2
dog(485781) Ras association (RalGDS/AF-6) domain family member 2
domestic cat(101101378) Ras association (RalGDS/AF-6) domain family member 2
cow(282337) Ras association (RalGDS/AF-6) domain family member 2
sheep(101113613) Ras association (RalGDS/AF-6) domain family member 2
domestic guinea pig(100714425) Ras association (RalGDS/AF-6) domain family member 2
naked mole-rat(101711854) Ras association (RalGDS/AF-6) domain family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014737 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014737 Rosetta Predictions human pricing
NM_170774 Rosetta Predictions human pricing
NM_001037096 Rosetta Predictions rat pricing
NM_175445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346188 predicted 606
2 SASI_Hs01_00140607 predicted 1663
3 SASI_Hs01_00140608 predicted 1066
4 SASI_Hs01_00140609 predicted 993
5 SASI_Hs01_00140610 predicted 650
6 SASI_Hs01_00140611 predicted 1006
7 SASI_Hs01_00140612 predicted 848
8 SASI_Hs01_00140613 predicted 940
9 SASI_Hs01_00140615 predicted 504
10 SASI_Hs01_00140616 predicted 380
11 SASI_Hs01_00140614 predicted 1672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367746 predicted 465
2 SASI_Hs01_00220892 predicted 1523
3 SASI_Hs01_00220893 predicted 928
4 SASI_Hs01_00220894 predicted 857
5 SASI_Hs01_00220895 predicted 504
6 SASI_Hs01_00220896 predicted 864
7 SASI_Hs01_00220897 predicted 698
8 SASI_Hs01_00220898 predicted 792
9 SASI_Hs01_00220900 predicted 356
10 SASI_Hs01_00220901 predicted 246
11 SASI_Hs01_00220899 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057115 predicted 544
2 SASI_Rn02_00204228 predicted 346
3 SASI_Rn01_00057117 predicted 292
4 SASI_Rn01_00057118 predicted 724
5 SASI_Rn01_00057119 predicted 704
6 SASI_Rn01_00057120 predicted 1020
7 SASI_Rn01_00057121 predicted 1189
8 SASI_Rn01_00057122 predicted 475
9 SASI_Rn01_00057123 predicted 231
10 SASI_Rn01_00057124 predicted 1045
11 SASI_Rn01_00057116 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026195 predicted 1392
2 SASI_Mm02_00346346 predicted 400
3 SASI_Mm01_00026196 predicted 1057
4 SASI_Mm01_00026197 predicted 1118
5 SASI_Mm01_00026200 predicted 1393
6 SASI_Mm01_00026201 predicted 895
7 SASI_Mm01_00026202 predicted 834
8 SASI_Mm01_00026203 predicted 592
9 SASI_Mm01_00026204 predicted 501
10 SASI_Mm02_00346347 predicted 1279
11 SASI_Mm01_00026198 predicted 424
12 SASI_Mm01_00026199 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175445
VALIDATED
RASSF2 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175445.4-1525s21c1
Sequence:CCGGCGCATACGCAAGTGTGCATATCTCGAGATATGCACACTTGCGTATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-2900s1c1
Sequence:CCGGCCCGTTATCTTTATCTTGAATCTCGAGATTCAAGATAAAGATAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-423s1c1
Sequence:CCGGGAAGTGGATATGCCAGTTGAACTCGAGTTCAACTGGCATATCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175445.3-123s1c1
Sequence:CCGGCCATGCGGACAAGACAAGTATCTCGAGATACTTGTCTTGTCCGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-911s1c1
Sequence:CCGGCCAGTATATAAAGTTCGAGATCTCGAGATCTCGAACTTTATATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175445.4-1182s21c1
Sequence:CCGGGTACACTGTGCTCCGGCTAATCTCGAGATTAGCCGGAGCACAGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175445.4-897s21c1
Sequence:CCGGCAACAAGTTTAAGATTGAGAACTCGAGTTCTCAATCTTAAACTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175445.4-1569s21c1
Sequence:CCGGCTCTCTGATGTTCTTACATTTCTCGAGAAATGTAAGAACATCAGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175445
VALIDATED
RASSF2 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175445.4-1525s21c1
Sequence:CCGGCGCATACGCAAGTGTGCATATCTCGAGATATGCACACTTGCGTATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-2900s1c1
Sequence:CCGGCCCGTTATCTTTATCTTGAATCTCGAGATTCAAGATAAAGATAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-423s1c1
Sequence:CCGGGAAGTGGATATGCCAGTTGAACTCGAGTTCAACTGGCATATCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175445.3-123s1c1
Sequence:CCGGCCATGCGGACAAGACAAGTATCTCGAGATACTTGTCTTGTCCGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-911s1c1
Sequence:CCGGCCAGTATATAAAGTTCGAGATCTCGAGATCTCGAACTTTATATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175445.4-1182s21c1
Sequence:CCGGGTACACTGTGCTCCGGCTAATCTCGAGATTAGCCGGAGCACAGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175445.4-897s21c1
Sequence:CCGGCAACAAGTTTAAGATTGAGAACTCGAGTTCTCAATCTTAAACTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175445.4-1569s21c1
Sequence:CCGGCTCTCTGATGTTCTTACATTTCTCGAGAAATGTAAGAACATCAGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175445
VALIDATED
RASSF2 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175445.4-1525s21c1
Sequence:CCGGCGCATACGCAAGTGTGCATATCTCGAGATATGCACACTTGCGTATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-2900s1c1
Sequence:CCGGCCCGTTATCTTTATCTTGAATCTCGAGATTCAAGATAAAGATAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-423s1c1
Sequence:CCGGGAAGTGGATATGCCAGTTGAACTCGAGTTCAACTGGCATATCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175445.3-123s1c1
Sequence:CCGGCCATGCGGACAAGACAAGTATCTCGAGATACTTGTCTTGTCCGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175445.3-911s1c1
Sequence:CCGGCCAGTATATAAAGTTCGAGATCTCGAGATCTCGAACTTTATATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175445.4-1182s21c1
Sequence:CCGGGTACACTGTGCTCCGGCTAATCTCGAGATTAGCCGGAGCACAGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175445.4-897s21c1
Sequence:CCGGCAACAAGTTTAAGATTGAGAACTCGAGTTCTCAATCTTAAACTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175445.4-1569s21c1
Sequence:CCGGCTCTCTGATGTTCTTACATTTCTCGAGAAATGTAAGAACATCAGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014737
VALIDATED
RASSF2 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000077888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-3646s1c1
Sequence:CCGGGCGTGCAATGAACCTGAAATTCTCGAGAATTTCAGGTTCATTGCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014737.1-905s1c1
Sequence:CCGGGCCACCGATTACCCGCTGATTCTCGAGAATCAGCGGGTAATCGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-274s1c1
Sequence:CCGGTCTGAAGACCTACAACTTGTACTCGAGTACAAGTTGTAGGTCTTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-277s1c1
Sequence:CCGGGAAGACCTACAACTTGTACTACTCGAGTAGTACAAGTTGTAGGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014737
VALIDATED
RASSF2 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000077888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-3646s1c1
Sequence:CCGGGCGTGCAATGAACCTGAAATTCTCGAGAATTTCAGGTTCATTGCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014737.1-905s1c1
Sequence:CCGGGCCACCGATTACCCGCTGATTCTCGAGAATCAGCGGGTAATCGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-274s1c1
Sequence:CCGGTCTGAAGACCTACAACTTGTACTCGAGTACAAGTTGTAGGTCTTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-277s1c1
Sequence:CCGGGAAGACCTACAACTTGTACTACTCGAGTAGTACAAGTTGTAGGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014737
VALIDATED
RASSF2 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000077888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-3646s1c1
Sequence:CCGGGCGTGCAATGAACCTGAAATTCTCGAGAATTTCAGGTTCATTGCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014737.1-905s1c1
Sequence:CCGGGCCACCGATTACCCGCTGATTCTCGAGAATCAGCGGGTAATCGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-274s1c1
Sequence:CCGGTCTGAAGACCTACAACTTGTACTCGAGTACAAGTTGTAGGTCTTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014737.1-277s1c1
Sequence:CCGGGAAGACCTACAACTTGTACTACTCGAGTAGTACAAGTTGTAGGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)