EMAIL THIS PAGE TO A FRIEND

RASSF5

Ras association (RalGDS/AF-6) domain family member 5

98 Gene Product Result for
Synonyms: Maxp1 NORE1 NORE1A NORE1B RAPL RASSF3
UniProtKB ID: Q8WWW0, A8K1E6, Q5SY32, Q8WWV9, Q8WXF4, Q9BT99
Gene ID:
Human(83593) Summary: This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(54354) Ras association (RalGDS/AF-6) domain family member 5
Rat(54355) Ras association (RalGDS/AF-6) domain family member 5
chicken(419844) Ras association (RalGDS/AF-6) domain family member 5
dog(607454) Ras association (RalGDS/AF-6) domain family member 5
domestic cat(101089486) Ras association (RalGDS/AF-6) domain family member 5
naked mole-rat(101697054) Ras association (RalGDS/AF-6) domain family member 5
domestic guinea pig(100716188) Ras association (RalGDS/AF-6) domain family member 5
cow(539767) Ras association (RalGDS/AF-6) domain family member 5
sheep(101117178) Ras association (RalGDS/AF-6) domain family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031437 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031437 Rosetta Predictions human pricing
NM_182663 Rosetta Predictions human pricing
NM_182664 Rosetta Predictions human pricing
NM_182665 Rosetta Predictions human pricing
NM_019365 Rosetta Predictions rat pricing
NM_018750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058751 predicted 591 154.00
2 SASI_Hs01_00058752 predicted 757 154.00
3 SASI_Hs01_00058753 predicted 769 154.00
4 SASI_Hs01_00058754 predicted 712 154.00
5 SASI_Hs01_00058755 predicted 581 154.00
6 SASI_Hs01_00058756 predicted 548 154.00
7 SASI_Hs01_00058757 predicted 618 154.00
8 SASI_Hs01_00058758 predicted 561 154.00
9 SASI_Hs01_00058759 predicted 740 154.00
10 SASI_Hs01_00058760 predicted 601 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370820 predicted 1687 154.00
2 SASI_Hs02_00370821 predicted 1721 154.00
3 SASI_Hs02_00370822 predicted 1527 154.00
4 SASI_Hs02_00370823 predicted 1516 154.00
5 SASI_Hs01_00013484 predicted 706 154.00
6 SASI_Hs02_00370824 predicted 1534 154.00
7 SASI_Hs01_00013485 predicted 578 154.00
8 SASI_Hs02_00370825 predicted 1516 154.00
9 SASI_Hs02_00370826 predicted 688 154.00
10 SASI_Hs01_00013489 predicted 727 154.00
11 SASI_Hs01_00013481 predicted 588 154.00
12 SASI_Hs01_00013482 predicted 761 154.00
13 SASI_Hs01_00013483 predicted 770 154.00
14 SASI_Hs01_00013486 predicted 552 154.00
15 SASI_Hs01_00013487 predicted 619 154.00
16 SASI_Hs01_00013488 predicted 564 154.00
17 SASI_Hs01_00013490 predicted 610 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109025 predicted 582 154.00
2 SASI_Hs01_00109028 predicted 702 154.00
3 SASI_Hs02_00370827 predicted 1407 154.00
4 SASI_Hs01_00109029 predicted 569 154.00
5 SASI_Hs02_00370828 predicted 828 154.00
6 SASI_Hs02_00370829 predicted 752 154.00
7 SASI_Hs02_00370830 predicted 570 154.00
8 SASI_Hs02_00370831 predicted 1445 154.00
9 SASI_Hs01_00109030 predicted 543 154.00
10 SASI_Hs02_00370832 predicted 766 154.00
11 SASI_Hs01_00109026 predicted 760 154.00
12 SASI_Hs01_00109027 predicted 764 154.00
13 SASI_Hs01_00109031 predicted 627 154.00
14 SASI_Hs01_00109032 predicted 571 154.00
15 SASI_Hs01_00109033 predicted 740 154.00
16 SASI_Hs01_00109034 predicted 608 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370833 predicted 1575 154.00
2 SASI_Hs02_00370834 predicted 1615 154.00
3 SASI_Hs02_00370835 predicted 1419 154.00
4 SASI_Hs02_00370836 predicted 1402 154.00
5 SASI_Hs02_00370837 predicted 594 154.00
6 SASI_Hs02_00370838 predicted 1421 154.00
7 SASI_Hs02_00370839 predicted 1409 154.00
8 SASI_Hs02_00370840 predicted 491 154.00
9 SASI_Hs02_00370841 predicted 471 154.00
10 SASI_Hs02_00370842 predicted 508 154.00
11 SASI_Hs01_00129046 predicted 821 154.00
12 SASI_Hs01_00129047 predicted 757 154.00
13 SASI_Hs01_00129048 predicted 820 154.00
14 SASI_Hs01_00129049 predicted 852 154.00
15 SASI_Hs01_00129050 predicted 818 154.00
16 SASI_Hs01_00129051 predicted 814 154.00
17 SASI_Hs01_00129052 predicted 854 154.00
18 SASI_Hs01_00129053 predicted 752 154.00
19 SASI_Hs01_00129054 predicted 842 154.00
20 SASI_Hs01_00129055 predicted 844 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262385 predicted 825 154.00
2 SASI_Rn01_00092267 predicted 743 154.00
3 SASI_Rn01_00092268 predicted 1191 154.00
4 SASI_Rn01_00092269 predicted 818 154.00
5 SASI_Rn01_00092270 predicted 969 154.00
6 SASI_Rn01_00092271 predicted 1373 154.00
7 SASI_Rn01_00092273 predicted 882 154.00
8 SASI_Rn01_00092274 predicted 983 154.00
9 SASI_Rn01_00092275 predicted 1127 154.00
10 SASI_Rn01_00092276 predicted 940 154.00
11 SASI_Rn01_00092272 predicted 1081 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102755 predicted 1342 154.00
2 SASI_Mm01_00102756 predicted 846 154.00
3 SASI_Mm02_00324027 predicted 1007 154.00
4 SASI_Mm01_00102757 predicted 1104 154.00
5 SASI_Mm01_00102758 predicted 737 154.00
6 SASI_Mm01_00102759 predicted 665 154.00
7 SASI_Mm01_00102760 predicted 889 154.00
8 SASI_Mm01_00102761 predicted 741 154.00
9 SASI_Mm01_00102762 predicted 1251 154.00
10 SASI_Mm01_00102763 predicted 675 154.00
11 SASI_Mm01_00102764 predicted 811 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018750
RASSF5 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018750.3-744s21c1
Sequence:CCGGAGGTTTCATCAAAGTGCATTTCTCGAGAAATGCACTTTGATGAAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018750.3-1723s21c1
Sequence:CCGGAGGATCAAATGTGGCATATTCCTCGAGGAATATGCCACATTTGATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-1177s1c1
Sequence:CCGGGAGCAGGACAAGATCCATCAACTCGAGTTGATGGATCTTGTCCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-1066s1c1
Sequence:CCGGGACACCGATGTTCTCAGCTTTCTCGAGAAAGCTGAGAACATCGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-982s1c1
Sequence:CCGGCGGATACACAAAGATGGACAACTCGAGTTGTCCATCTTTGTGTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-462s1c1
Sequence:CCGGGCGCTGCGCTAATTGTAAATTCTCGAGAATTTACAATTAGCGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-868s1c1
Sequence:CCGGGATGCCATCAAGCAGCTACATCTCGAGATGTAGCTGCTTGATGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018750
RASSF5 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018750.3-744s21c1
Sequence:CCGGAGGTTTCATCAAAGTGCATTTCTCGAGAAATGCACTTTGATGAAACCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000419744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018750.3-1723s21c1
Sequence:CCGGAGGATCAAATGTGGCATATTCCTCGAGGAATATGCCACATTTGATCCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-1177s1c1
Sequence:CCGGGAGCAGGACAAGATCCATCAACTCGAGTTGATGGATCTTGTCCTGCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-1066s1c1
Sequence:CCGGGACACCGATGTTCTCAGCTTTCTCGAGAAAGCTGAGAACATCGGTGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-982s1c1
Sequence:CCGGCGGATACACAAAGATGGACAACTCGAGTTGTCCATCTTTGTGTATCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-462s1c1
Sequence:CCGGGCGCTGCGCTAATTGTAAATTCTCGAGAATTTACAATTAGCGCAGCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-868s1c1
Sequence:CCGGGATGCCATCAAGCAGCTACATCTCGAGATGTAGCTGCTTGATGGCATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018750
RASSF5 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018750.3-744s21c1
Sequence:CCGGAGGTTTCATCAAAGTGCATTTCTCGAGAAATGCACTTTGATGAAACCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018750.3-1723s21c1
Sequence:CCGGAGGATCAAATGTGGCATATTCCTCGAGGAATATGCCACATTTGATCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-1177s1c1
Sequence:CCGGGAGCAGGACAAGATCCATCAACTCGAGTTGATGGATCTTGTCCTGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-1066s1c1
Sequence:CCGGGACACCGATGTTCTCAGCTTTCTCGAGAAAGCTGAGAACATCGGTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-982s1c1
Sequence:CCGGCGGATACACAAAGATGGACAACTCGAGTTGTCCATCTTTGTGTATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-462s1c1
Sequence:CCGGGCGCTGCGCTAATTGTAAATTCTCGAGAATTTACAATTAGCGCAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018750.1-868s1c1
Sequence:CCGGGATGCCATCAAGCAGCTACATCTCGAGATGTAGCTGCTTGATGGCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182663
RASSF5 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-1186s21c1
Sequence:GTACCGGCTTCAGAACTTCCTAACAATCCTCGAGGATTGTTAGGAAGTTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-761s21c1
Sequence:CCGGCCTACACGGGTTTCATCAAAGCTCGAGCTTTGATGAAACCCGTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182663.2-1718s21c1
Sequence:CCGGGCCACGTACAGGACCATTATTCTCGAGAATAATGGTCCTGTACGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-1117s21c1
Sequence:CCGGGTCCTCAGCTTTGTGCTAAAGCTCGAGCTTTAGCACAAAGCTGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-567s21c1
Sequence:CCGGCAGTCAGCAGGAGGGTTTATCCTCGAGGATAAACCCTCCTGCTGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182663
RASSF5 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-1186s21c1
Sequence:GTACCGGCTTCAGAACTTCCTAACAATCCTCGAGGATTGTTAGGAAGTTCTGAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-761s21c1
Sequence:CCGGCCTACACGGGTTTCATCAAAGCTCGAGCTTTGATGAAACCCGTGTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182663.2-1718s21c1
Sequence:CCGGGCCACGTACAGGACCATTATTCTCGAGAATAATGGTCCTGTACGTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-1117s21c1
Sequence:CCGGGTCCTCAGCTTTGTGCTAAAGCTCGAGCTTTAGCACAAAGCTGAGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-567s21c1
Sequence:CCGGCAGTCAGCAGGAGGGTTTATCCTCGAGGATAAACCCTCCTGCTGACTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182663
RASSF5 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-1186s21c1
Sequence:GTACCGGCTTCAGAACTTCCTAACAATCCTCGAGGATTGTTAGGAAGTTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-761s21c1
Sequence:CCGGCCTACACGGGTTTCATCAAAGCTCGAGCTTTGATGAAACCCGTGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182663.2-1718s21c1
Sequence:CCGGGCCACGTACAGGACCATTATTCTCGAGAATAATGGTCCTGTACGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-1117s21c1
Sequence:CCGGGTCCTCAGCTTTGTGCTAAAGCTCGAGCTTTAGCACAAAGCTGAGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182663.2-567s21c1
Sequence:CCGGCAGTCAGCAGGAGGGTTTATCCTCGAGGATAAACCCTCCTGCTGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031437
RASSF5 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family member 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000002083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-504s1c1
Sequence:CCGGGCGCTGCACTAACTGTAAATTCTCGAGAATTTACAGTTAGTGCAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031437.x-1588s1c1
Sequence:CCGGGCCACGTACAGGACCATTATTCTCGAGAATAATGGTCCTGTACGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-693s1c1
Sequence:CCGGGCAGAAGATCGACAGCTACAACTCGAGTTGTAGCTGTCGATCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-733s1c1
Sequence:CCGGCTGGGCATGAAACTGAGTGAACTCGAGTTCACTCAGTTTCATGCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031437
RASSF5 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family member 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000002083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-504s1c1
Sequence:CCGGGCGCTGCACTAACTGTAAATTCTCGAGAATTTACAGTTAGTGCAGCGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031437.x-1588s1c1
Sequence:CCGGGCCACGTACAGGACCATTATTCTCGAGAATAATGGTCCTGTACGTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-693s1c1
Sequence:CCGGGCAGAAGATCGACAGCTACAACTCGAGTTGTAGCTGTCGATCTTCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-733s1c1
Sequence:CCGGCTGGGCATGAAACTGAGTGAACTCGAGTTCACTCAGTTTCATGCCCAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031437
RASSF5 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family member 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000002083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-504s1c1
Sequence:CCGGGCGCTGCACTAACTGTAAATTCTCGAGAATTTACAGTTAGTGCAGCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031437.x-1588s1c1
Sequence:CCGGGCCACGTACAGGACCATTATTCTCGAGAATAATGGTCCTGTACGTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-693s1c1
Sequence:CCGGGCAGAAGATCGACAGCTACAACTCGAGTTGTAGCTGTCGATCTTCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031437.x-733s1c1
Sequence:CCGGCTGGGCATGAAACTGAGTGAACTCGAGTTCACTCAGTTTCATGCCCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)