EMAIL THIS PAGE TO A FRIEND

RASSF7

Ras association (RalGDS/AF-6) domain family (N-terminal) member 7

51 Gene Product Result for
Synonyms: C11orf13 HRAS1 HRC1
UniProtKB ID: Q02833, G5E9N9, Q3KP41, Q3KP42
Gene ID:
Mouse(66985) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Rat(293623) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
chicken(423107) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
domestic cat(101084575) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
dog(607151) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
domestic guinea pig(100718896) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
naked mole-rat(101713952) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
cow(538490) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
sheep(101103935) Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003475 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003475 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003475 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003475 Rosetta Predictions human pricing
NM_001106317 Rosetta Predictions rat pricing
NM_025886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123741 predicted 896
2 SASI_Hs01_00123742 predicted 209
3 SASI_Hs01_00123743 predicted 211
4 SASI_Hs01_00123744 predicted 773
5 SASI_Hs01_00123745 predicted 1183
6 SASI_Hs01_00123746 predicted 618
7 SASI_Hs01_00123747 predicted 1167
8 SASI_Hs01_00123748 predicted 1081
9 SASI_Hs01_00123749 predicted 856
10 SASI_Hs01_00123750 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217788 predicted 971
2 SASI_Rn02_00217789 predicted 1145
3 SASI_Rn02_00217790 predicted 773
4 SASI_Rn02_00217791 predicted 1126
5 SASI_Rn02_00217792 predicted 550
6 SASI_Rn02_00217793 predicted 1137
7 SASI_Rn02_00217794 predicted 1088
8 SASI_Rn02_00217795 predicted 493
9 SASI_Rn02_00217796 predicted 248
10 SASI_Rn02_00217797 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155183 predicted 1048
2 SASI_Mm01_00155184 predicted 309
3 SASI_Mm01_00155185 predicted 626
4 SASI_Mm01_00155186 predicted 1250
5 SASI_Mm02_00329222 predicted 842
6 SASI_Mm02_00329223 predicted 962
7 SASI_Mm02_00329224 predicted 1266
8 SASI_Mm01_00155189 predicted 1223
9 SASI_Mm02_00329225 predicted 221
10 SASI_Mm01_00155190 predicted 455
11 SASI_Mm01_00155187 predicted 743
12 SASI_Mm01_00155188 predicted 527
13 SASI_Mm01_00155191 predicted 244
14 SASI_Mm01_00155192 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003475
VALIDATED
RASSF7 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-211s21c1
Sequence:CCGGAGTTGCTGCCACAAGAGTGTCCTCGAGGACACTCTTGTGGCAGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-1081s21c1
Sequence:CCGGACGCAGAACTCCTGGAGGTAGCTCGAGCTACCTCCAGGAGTTCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-342s21c1
Sequence:CCGGCCGGAACGCTGCCTAATTCGTCTCGAGACGAATTAGGCAGCGTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-548s21c1
Sequence:CCGGTGAGGCCTTCTGGGAGCAAGACTCGAGTCTTGCTCCCAGAAGGCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003475.2-250s1c1
Sequence:CCGGCCAGGCCACCTGCGGACAGTTCTCGAGAACTGTCCGCAGGTGGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003475.2-735s1c1
Sequence:CCGGCCTCACCTATGGCATCTGCCACTCGAGTGGCAGATGCCATAGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003475.2-901s1c1
Sequence:CCGGGCTCCGTCAGTGCAACCTGCACTCGAGTGCAGGTTGCACTGACGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003475.2-145s1c1
Sequence:CCGGCATCGCACTAGCCCAAGCAATCTCGAGATTGCTTGGGCTAGTGCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003475
VALIDATED
RASSF7 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-211s21c1
Sequence:CCGGAGTTGCTGCCACAAGAGTGTCCTCGAGGACACTCTTGTGGCAGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-1081s21c1
Sequence:CCGGACGCAGAACTCCTGGAGGTAGCTCGAGCTACCTCCAGGAGTTCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-342s21c1
Sequence:CCGGCCGGAACGCTGCCTAATTCGTCTCGAGACGAATTAGGCAGCGTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-548s21c1
Sequence:CCGGTGAGGCCTTCTGGGAGCAAGACTCGAGTCTTGCTCCCAGAAGGCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003475.2-250s1c1
Sequence:CCGGCCAGGCCACCTGCGGACAGTTCTCGAGAACTGTCCGCAGGTGGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003475.2-735s1c1
Sequence:CCGGCCTCACCTATGGCATCTGCCACTCGAGTGGCAGATGCCATAGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003475.2-901s1c1
Sequence:CCGGGCTCCGTCAGTGCAACCTGCACTCGAGTGCAGGTTGCACTGACGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003475.2-145s1c1
Sequence:CCGGCATCGCACTAGCCCAAGCAATCTCGAGATTGCTTGGGCTAGTGCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003475
VALIDATED
RASSF7 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-211s21c1
Sequence:CCGGAGTTGCTGCCACAAGAGTGTCCTCGAGGACACTCTTGTGGCAGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-1081s21c1
Sequence:CCGGACGCAGAACTCCTGGAGGTAGCTCGAGCTACCTCCAGGAGTTCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-342s21c1
Sequence:CCGGCCGGAACGCTGCCTAATTCGTCTCGAGACGAATTAGGCAGCGTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003475.3-548s21c1
Sequence:CCGGTGAGGCCTTCTGGGAGCAAGACTCGAGTCTTGCTCCCAGAAGGCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003475.2-250s1c1
Sequence:CCGGCCAGGCCACCTGCGGACAGTTCTCGAGAACTGTCCGCAGGTGGCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003475.2-735s1c1
Sequence:CCGGCCTCACCTATGGCATCTGCCACTCGAGTGGCAGATGCCATAGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003475.2-901s1c1
Sequence:CCGGGCTCCGTCAGTGCAACCTGCACTCGAGTGCAGGTTGCACTGACGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003475.2-145s1c1
Sequence:CCGGCATCGCACTAGCCCAAGCAATCTCGAGATTGCTTGGGCTAGTGCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025886
VALIDATED
RASSF7 MISSION shRNA Bacterial Glycerol Stock
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-1055s21c1
Sequence:CCGGCAGGACCTTCTGTCTCCAAATCTCGAGATTTGGAGACAGAAGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025886.3-1318s21c1
Sequence:CCGGCAACTGTTATCCTAGTCTTTCCTCGAGGAAAGACTAGGATAACAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025886.3-632s21c1
Sequence:CCGGCAAGAGCTGCAACGAGAACAACTCGAGTTGTTCTCGTTGCAGCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-209s21c1
Sequence:CCGGATAGGCCAGACAGGTCGATTTCTCGAGAAATCGACCTGTCTGGCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-1021s21c1
Sequence:CCGGACCTCCACAGCTGGATAGAACCTCGAGGTTCTATCCAGCTGTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025886.2-1004s1c1
Sequence:CCGGCTGTCTCCAAATAGAGGAGAACTCGAGTTCTCCTCTATTTGGAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025886.2-113s1c1
Sequence:CCGGACCTGCCAAGAAGTGGTCATTCTCGAGAATGACCACTTCTTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-572s1c1
Sequence:CCGGCAAGAGCTGCAACGAGAACAACTCGAGTTGTTCTCGTTGCAGCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-995s1c1
Sequence:CCGGCAGGACCTTCTGTCTCCAAATCTCGAGATTTGGAGACAGAAGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-253s1c1
Sequence:CCGGGTTTGCCAATGATGTTCAGTTCTCGAGAACTGAACATCATTGGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025886
VALIDATED
RASSF7 MISSION shRNA shRNA Plasmid DNA
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-1055s21c1
Sequence:CCGGCAGGACCTTCTGTCTCCAAATCTCGAGATTTGGAGACAGAAGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025886.3-1318s21c1
Sequence:CCGGCAACTGTTATCCTAGTCTTTCCTCGAGGAAAGACTAGGATAACAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025886.3-632s21c1
Sequence:CCGGCAAGAGCTGCAACGAGAACAACTCGAGTTGTTCTCGTTGCAGCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-209s21c1
Sequence:CCGGATAGGCCAGACAGGTCGATTTCTCGAGAAATCGACCTGTCTGGCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-1021s21c1
Sequence:CCGGACCTCCACAGCTGGATAGAACCTCGAGGTTCTATCCAGCTGTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025886.2-1004s1c1
Sequence:CCGGCTGTCTCCAAATAGAGGAGAACTCGAGTTCTCCTCTATTTGGAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025886.2-113s1c1
Sequence:CCGGACCTGCCAAGAAGTGGTCATTCTCGAGAATGACCACTTCTTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-572s1c1
Sequence:CCGGCAAGAGCTGCAACGAGAACAACTCGAGTTGTTCTCGTTGCAGCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-995s1c1
Sequence:CCGGCAGGACCTTCTGTCTCCAAATCTCGAGATTTGGAGACAGAAGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-253s1c1
Sequence:CCGGGTTTGCCAATGATGTTCAGTTCTCGAGAACTGAACATCATTGGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025886
VALIDATED
RASSF7 MISSION shRNA Lentiviral Transduction Particles
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-1055s21c1
Sequence:CCGGCAGGACCTTCTGTCTCCAAATCTCGAGATTTGGAGACAGAAGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025886.3-1318s21c1
Sequence:CCGGCAACTGTTATCCTAGTCTTTCCTCGAGGAAAGACTAGGATAACAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025886.3-632s21c1
Sequence:CCGGCAAGAGCTGCAACGAGAACAACTCGAGTTGTTCTCGTTGCAGCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-209s21c1
Sequence:CCGGATAGGCCAGACAGGTCGATTTCTCGAGAAATCGACCTGTCTGGCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025886.3-1021s21c1
Sequence:CCGGACCTCCACAGCTGGATAGAACCTCGAGGTTCTATCCAGCTGTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025886.2-1004s1c1
Sequence:CCGGCTGTCTCCAAATAGAGGAGAACTCGAGTTCTCCTCTATTTGGAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025886.2-113s1c1
Sequence:CCGGACCTGCCAAGAAGTGGTCATTCTCGAGAATGACCACTTCTTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-572s1c1
Sequence:CCGGCAAGAGCTGCAACGAGAACAACTCGAGTTGTTCTCGTTGCAGCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-995s1c1
Sequence:CCGGCAGGACCTTCTGTCTCCAAATCTCGAGATTTGGAGACAGAAGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025886.2-253s1c1
Sequence:CCGGGTTTGCCAATGATGTTCAGTTCTCGAGAACTGAACATCATTGGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)