EMAIL THIS PAGE TO A FRIEND

RAX

retina and anterior neural fold homeobox

52 Gene Product Result for
Synonyms: MCOP3 RX
UniProtKB ID: Q9Y2V3
Gene ID:
Human(30062) Summary: This gene encodes a homeobox-containing transcription factor that functions in eye development. The gene is expressed early in the eye primordia, and is required for retinal cell fate determination and also regulates stem cell proliferation. Mutations in this gene have been reported in patients with defects in ocular development, including microphthalmia, anophthalmia, and coloboma.[provided by RefSeq, Oct 2009]
Mouse(19434) retina and anterior neural fold homeobox
Rat(114213) retina and anterior neural fold homeobox
chicken(100677794) retina and anterior neural fold homeobox
dog(610136) retina and anterior neural fold homeobox
domestic cat(101089402) retina and anterior neural fold homeobox
domestic guinea pig(100728548) retina and anterior neural fold homeobox
naked mole-rat(101722712) retina and anterior neural fold homeobox
cow(615339) retina and anterior neural fold homeobox
sheep(101117038) retina and anterior neural fold homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013435 Rosetta Predictions human pricing
NM_053678 Rosetta Predictions rat pricing
NM_013833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344827 predicted 1664
2 SASI_Hs02_00344828 predicted 1548
3 SASI_Hs02_00344829 predicted 1590
4 SASI_Hs02_00344830 predicted 1706
5 SASI_Hs01_00220409 predicted 1269
6 SASI_Hs02_00344831 predicted 568
7 SASI_Hs02_00344832 predicted 550
8 SASI_Hs02_00344833 predicted 1545
9 SASI_Hs02_00344834 predicted 1183
10 SASI_Hs02_00344835 predicted 711
11 SASI_Hs01_00220400 predicted 1348
12 SASI_Hs01_00220401 predicted 1169
13 SASI_Hs01_00220402 predicted 1405
14 SASI_Hs01_00220403 predicted 1161
15 SASI_Hs01_00220404 predicted 1433
16 SASI_Hs01_00220405 predicted 1171
17 SASI_Hs01_00220406 predicted 1429
18 SASI_Hs01_00220407 predicted 1203
19 SASI_Hs01_00220408 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114943 predicted 418
2 SASI_Rn01_00114944 predicted 589
3 SASI_Rn02_00266419 predicted 377
4 SASI_Rn01_00114945 predicted 504
5 SASI_Rn01_00114946 predicted 458
6 SASI_Rn01_00114947 predicted 358
7 SASI_Rn01_00114948 predicted 294
8 SASI_Rn01_00114949 predicted 448
9 SASI_Rn01_00114950 predicted 436
10 SASI_Rn01_00114951 predicted 428
11 SASI_Rn01_00114952 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201010 predicted 1312
2 SASI_Mm01_00201011 predicted 1406
3 SASI_Mm01_00201012 predicted 1243
4 SASI_Mm01_00201013 predicted 696
5 SASI_Mm01_00201014 predicted 802
6 SASI_Mm01_00201015 predicted 1426
7 SASI_Mm01_00201016 predicted 1257
8 SASI_Mm01_00201017 predicted 1313
9 SASI_Mm01_00201018 predicted 800
10 SASI_Mm01_00201019 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013833
RAX MISSION shRNA Bacterial Glycerol Stock
retina and anterior neural fold homeobox
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-736s1c1
Sequence:CCGGCGCCTTCGAGAAGTCCCACTACTCGAGTAGTGGGACTTCTCGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-562s1c1
Sequence:CCGGCGAAGCTACTAGGCCCTGCTACTCGAGTAGCAGGGCCTAGTAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-397s1c1
Sequence:CCGGCTTTACCAAGGAAGACGGCATCTCGAGATGCCGTCTTCCTTGGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-1267s1c1
Sequence:CCGGGCACATCCAGGCCATCGGAAACTCGAGTTTCCGATGGCCTGGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-862s1c1
Sequence:CCGGGAAACTGGAAGTGTCGTCCATCTCGAGATGGACGACACTTCCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013833.2-363s21c1
Sequence:CCGGTCGCGTTTGCACAGCATCGAACTCGAGTTCGATGCTGTGCAAACGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013833.2-1455s21c1
Sequence:CCGGTCGCTGTCAGAGGGACAAACTCTCGAGAGTTTGTCCCTCTGACAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013833
RAX MISSION shRNA shRNA Plasmid DNA
retina and anterior neural fold homeobox
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-736s1c1
Sequence:CCGGCGCCTTCGAGAAGTCCCACTACTCGAGTAGTGGGACTTCTCGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-562s1c1
Sequence:CCGGCGAAGCTACTAGGCCCTGCTACTCGAGTAGCAGGGCCTAGTAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-397s1c1
Sequence:CCGGCTTTACCAAGGAAGACGGCATCTCGAGATGCCGTCTTCCTTGGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-1267s1c1
Sequence:CCGGGCACATCCAGGCCATCGGAAACTCGAGTTTCCGATGGCCTGGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-862s1c1
Sequence:CCGGGAAACTGGAAGTGTCGTCCATCTCGAGATGGACGACACTTCCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013833.2-363s21c1
Sequence:CCGGTCGCGTTTGCACAGCATCGAACTCGAGTTCGATGCTGTGCAAACGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013833.2-1455s21c1
Sequence:CCGGTCGCTGTCAGAGGGACAAACTCTCGAGAGTTTGTCCCTCTGACAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013833
RAX MISSION shRNA Lentiviral Transduction Particles
retina and anterior neural fold homeobox
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-736s1c1
Sequence:CCGGCGCCTTCGAGAAGTCCCACTACTCGAGTAGTGGGACTTCTCGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-562s1c1
Sequence:CCGGCGAAGCTACTAGGCCCTGCTACTCGAGTAGCAGGGCCTAGTAGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-397s1c1
Sequence:CCGGCTTTACCAAGGAAGACGGCATCTCGAGATGCCGTCTTCCTTGGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-1267s1c1
Sequence:CCGGGCACATCCAGGCCATCGGAAACTCGAGTTTCCGATGGCCTGGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013833.1-862s1c1
Sequence:CCGGGAAACTGGAAGTGTCGTCCATCTCGAGATGGACGACACTTCCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013833.2-363s21c1
Sequence:CCGGTCGCGTTTGCACAGCATCGAACTCGAGTTCGATGCTGTGCAAACGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013833.2-1455s21c1
Sequence:CCGGTCGCTGTCAGAGGGACAAACTCTCGAGAGTTTGTCCCTCTGACAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013435
RAX MISSION shRNA Bacterial Glycerol Stock
retina and anterior neural fold homeobox
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-310s1c1
Sequence:CCGGGTTTACCAAGGACGACGGGATCTCGAGATCCCGTCGTCCTTGGTAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-283s1c1
Sequence:CCGGACTTCACAGCATCGAGGCCATCTCGAGATGGCCTCGATGCTGTGAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013435.2-607s21c1
Sequence:CCGGCACGACTTTCACCACGTACCACTCGAGTGGTACGTGGTGAAAGTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-560s1c1
Sequence:CCGGGCGAAACTGTCAGAGGAGGAACTCGAGTTCCTCCTCTGACAGTTTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-1174s1c1
Sequence:CCGGGCGTCTGAAAGCCAAGGAGCACTCGAGTGCTCCTTGGCTTTCAGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-700s1c1
Sequence:CCGGCGGCAAGGTCAACCTACCAGACTCGAGTCTGGTAGGTTGACCTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013435.2-1671s21c1
Sequence:CCGGCTATTTGAGAGGAGAATTAAACTCGAGTTTAATTCTCCTCTCAAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013435
RAX MISSION shRNA shRNA Plasmid DNA
retina and anterior neural fold homeobox
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-310s1c1
Sequence:CCGGGTTTACCAAGGACGACGGGATCTCGAGATCCCGTCGTCCTTGGTAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-283s1c1
Sequence:CCGGACTTCACAGCATCGAGGCCATCTCGAGATGGCCTCGATGCTGTGAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013435.2-607s21c1
Sequence:CCGGCACGACTTTCACCACGTACCACTCGAGTGGTACGTGGTGAAAGTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-560s1c1
Sequence:CCGGGCGAAACTGTCAGAGGAGGAACTCGAGTTCCTCCTCTGACAGTTTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-1174s1c1
Sequence:CCGGGCGTCTGAAAGCCAAGGAGCACTCGAGTGCTCCTTGGCTTTCAGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-700s1c1
Sequence:CCGGCGGCAAGGTCAACCTACCAGACTCGAGTCTGGTAGGTTGACCTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013435.2-1671s21c1
Sequence:CCGGCTATTTGAGAGGAGAATTAAACTCGAGTTTAATTCTCCTCTCAAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013435
RAX MISSION shRNA Lentiviral Transduction Particles
retina and anterior neural fold homeobox
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-310s1c1
Sequence:CCGGGTTTACCAAGGACGACGGGATCTCGAGATCCCGTCGTCCTTGGTAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-283s1c1
Sequence:CCGGACTTCACAGCATCGAGGCCATCTCGAGATGGCCTCGATGCTGTGAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013435.2-607s21c1
Sequence:CCGGCACGACTTTCACCACGTACCACTCGAGTGGTACGTGGTGAAAGTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-560s1c1
Sequence:CCGGGCGAAACTGTCAGAGGAGGAACTCGAGTTCCTCCTCTGACAGTTTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-1174s1c1
Sequence:CCGGGCGTCTGAAAGCCAAGGAGCACTCGAGTGCTCCTTGGCTTTCAGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013435.1-700s1c1
Sequence:CCGGCGGCAAGGTCAACCTACCAGACTCGAGTCTGGTAGGTTGACCTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013435.2-1671s21c1
Sequence:CCGGCTATTTGAGAGGAGAATTAAACTCGAGTTTAATTCTCCTCTCAAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)