EMAIL THIS PAGE TO A FRIEND

RB1

retinoblastoma 1

227 Gene Product Result for
Synonyms: OSRC RB p105-Rb pRb pp110
UniProtKB ID: P06400, A8K5E3, P78499, Q5VW46, Q8IZL4
Gene ID:
Human(5925) Summary: The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
Mouse(19645) retinoblastoma 1
Rat(24708) retinoblastoma 1
cow(534712) retinoblastoma 1
sheep(100144755) retinoblastoma 1
Domestic Rabbit(100357431) retinoblastoma 1
naked mole-rat(101703701) retinoblastoma 1
Zebrafish(777733) retinoblastoma 1
chicken(386582) retinoblastoma 1
dog(476915) retinoblastoma 1
domestic cat(101101356) retinoblastoma 1
Horse(100057080) retinoblastoma 1
Gene Class: Cell_Division
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305397 ANTI-PHOSPHO-RB(S249) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305092 ANTI-PHOSPHO-RB(S608) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1305398 ANTI-PHOSPHO-RB(S612) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1305093 ANTI-PHOSPHO-RB(S780) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1305094 ANTI-PHOSPHO-RB(S788) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB1305095 ANTI-PHOSPHO-RB(S811) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry pricing
SAB4300109 Anti-phospho-RB1 (pSer780) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300107 Anti-phospho-RB1 (pSer795) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300108 Anti-phospho-RB1 (pSer807) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
R3403 Anti-phospho-Retinoblastoma (pSer249/pThr252) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB4504594 Anti-phospho-Retinoblastoma (pSer608) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301282 Anti-phospho-Retinoblastoma (pSer608) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
R3278 Anti-phospho-Retinoblastoma (pSer612) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
R4028 Anti-phospho-Retinoblastoma (pSer780) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
R6275 Anti-phospho-Retinoblastoma (pSer780) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
western blot pricing
SAB4504525 Anti-phospho-Retinoblastoma (pSer780) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504526 Anti-phospho-Retinoblastoma (pSer795) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
R3778 Anti-phospho-Retinoblastoma (pSer807) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4504527 Anti-phospho-Retinoblastoma (pSer807) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
R3903 Anti-phospho-Retinoblastoma (pSer807,811) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
R6400 Anti-phospho-Retinoblastoma (pSer807,811) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
western blot pricing
R4278 Anti-phospho-Retinoblastoma (pSer811) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB4504106 Anti-phospho-Retinoblastoma (pSer811) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
R3528 Anti-phospho-Retinoblastoma (pThr356) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
R4153 Anti-phospho-Retinoblastoma (pThr821) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
SAB4504107 Anti-phospho-Retinoblastoma (pThr821) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504204 Anti-phospho-Retinoblastoma (pThr826) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4300387 Anti-RB1 (Ab-780) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300385 Anti-RB1 (Ab-795) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300386 Anti-RB1 (Ab-807) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
AV33212 Anti-RB1 antibody produced in rabbit affinity isolated antibody guinea pig, rat, dog, rabbit, human, bovine, horse
western blot pricing
HPA050082 Anti-RB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
R6775 Anti-Retinoblastoma antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, microarray, western blot pricing
SAB4502583 Anti-Retinoblastoma antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB4502585 Anti-Retinoblastoma antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502586 Anti-Retinoblastoma antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502587 Anti-Retinoblastoma antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4502588 Anti-Retinoblastoma antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502590 Anti-Retinoblastoma antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4502591 Anti-Retinoblastoma antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4502584 Anti-Retinoblastoma, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502589 Anti-Retinoblastoma, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
R6878 Monoclonal Anti-phospho-Retinoblastoma (pSer795) antibody produced in mouse ~2 mg/mL, clone RB-10, purified immunoglobulin, buffered aqueous solution human, hamster, mouse, bovine, rat
ELISA, immunohistochemistry, microarray, western blot pricing
SAB5300213 Monoclonal Anti-RB1 antibody produced in mouse clone 7E4B8, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000321 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000321 siRNAs that have been validated in the lab human pricing
XM_001071121 Rosetta Predictions rat pricing
XM_344434 Rosetta Predictions rat pricing
NM_009029 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000321 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072600 validated 2868
2 SASI_Hs02_00302330 predicted 1303
3 SASI_Hs01_00072601 predicted 2538
4 SASI_Hs02_00302331 predicted 1277
5 SASI_Hs02_00302332 predicted 529
6 SASI_Hs01_00072603 predicted 2244
7 SASI_Hs01_00072604 predicted 1858
8 SASI_Hs01_00072605 predicted 1286
9 SASI_Hs01_00072608 predicted 2012
10 SASI_Hs01_00072609 predicted 3001
11 SASI_Hs01_00072602 predicted 1273
12 SASI_Hs01_00072606 predicted 3012
13 SASI_Hs01_00072607 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333945 predicted 2724
2 SASI_Rn02_00333946 predicted 829
3 SASI_Rn02_00333947 predicted 1342
4 SASI_Rn02_00333948 predicted 1153
5 SASI_Rn02_00333949 predicted 1515
6 SASI_Rn02_00333950 predicted 2382
7 SASI_Rn02_00333951 predicted 2677
8 SASI_Rn02_00333952 predicted 2103
9 SASI_Rn02_00333953 predicted 488
10 SASI_Rn02_00333954 predicted 1898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397071 predicted 2855
2 SASI_Rn02_00397072 predicted 958
3 SASI_Rn02_00397073 predicted 1465
4 SASI_Rn02_00397074 predicted 1277
5 SASI_Rn02_00397075 predicted 1637
6 SASI_Rn02_00397076 predicted 2510
7 SASI_Rn02_00397077 predicted 2814
8 SASI_Rn02_00397078 predicted 2229
9 SASI_Rn02_00397079 predicted 617
10 SASI_Rn02_00397080 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143032 predicted 1073
2 SASI_Mm02_00315181 predicted 1971
3 SASI_Mm01_00143033 predicted 2827
4 SASI_Mm02_00315182 predicted 973
5 SASI_Mm01_00143034 predicted 1601
6 SASI_Mm01_00143035 predicted 2623
7 SASI_Mm01_00143036 predicted 1249
8 SASI_Mm01_00143039 predicted 2203
9 SASI_Mm01_00143040 predicted 2783
10 SASI_Mm02_00315183 predicted 1220
11 SASI_Mm01_00143037 predicted 1205
12 SASI_Mm01_00143038 predicted 1834
13 SASI_Mm01_00143041 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000321
VALIDATED
RB1 MISSION shRNA Bacterial Glycerol Stock
retinoblastoma 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000321.1-1997s1c1
Sequence:CCGGCGCGTGTAAATTCTACTGCAACTCGAGTTGCAGTAGAATTTACACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000321.1-4075s1c1
Sequence:CCGGCCACATTATTTCTAGTCCAAACTCGAGTTTGGACTAGAAATAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000321.1-1455s1c1
Sequence:CCGGCGAAATTGGATCACAGCGATACTCGAGTATCGCTGTGATCCAATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000321.1-829s1c1
Sequence:CCGGCCTCCCATGTTGCTCAAAGAACTCGAGTTCTTTGAGCAACATGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000321.2-1516s21c1
Sequence:CCGGTCGCTTGTATTACCGAGTAATCTCGAGATTACTCGGTAATACAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-1630s21c1
Sequence:CCGGGTGCGCTCTTGAGGTTGTAATCTCGAGATTACAACCTCAAGAGCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-4612s21c1
Sequence:CCGGCAGAGATCGTGTATTGAGATTCTCGAGAATCTCAATACACGATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-4103s21c1
Sequence:CCGGCCACATTATTTCTAGTCCAAACTCGAGTTTGGACTAGAAATAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-2878s21c1
Sequence:CCGGGACTTCTACTCGAACACGAATCTCGAGATTCGTGTTCGAGTAGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000321
VALIDATED
RB1 MISSION shRNA shRNA Plasmid DNA
retinoblastoma 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000321.1-1997s1c1
Sequence:CCGGCGCGTGTAAATTCTACTGCAACTCGAGTTGCAGTAGAATTTACACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000321.1-4075s1c1
Sequence:CCGGCCACATTATTTCTAGTCCAAACTCGAGTTTGGACTAGAAATAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000321.1-1455s1c1
Sequence:CCGGCGAAATTGGATCACAGCGATACTCGAGTATCGCTGTGATCCAATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000321.1-829s1c1
Sequence:CCGGCCTCCCATGTTGCTCAAAGAACTCGAGTTCTTTGAGCAACATGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000321.2-1516s21c1
Sequence:CCGGTCGCTTGTATTACCGAGTAATCTCGAGATTACTCGGTAATACAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-1630s21c1
Sequence:CCGGGTGCGCTCTTGAGGTTGTAATCTCGAGATTACAACCTCAAGAGCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-4612s21c1
Sequence:CCGGCAGAGATCGTGTATTGAGATTCTCGAGAATCTCAATACACGATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-4103s21c1
Sequence:CCGGCCACATTATTTCTAGTCCAAACTCGAGTTTGGACTAGAAATAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-2878s21c1
Sequence:CCGGGACTTCTACTCGAACACGAATCTCGAGATTCGTGTTCGAGTAGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000321
VALIDATED
RB1 MISSION shRNA Lentiviral Transduction Particles
retinoblastoma 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000321.1-1997s1c1
Sequence:CCGGCGCGTGTAAATTCTACTGCAACTCGAGTTGCAGTAGAATTTACACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000321.1-4075s1c1
Sequence:CCGGCCACATTATTTCTAGTCCAAACTCGAGTTTGGACTAGAAATAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000321.1-1455s1c1
Sequence:CCGGCGAAATTGGATCACAGCGATACTCGAGTATCGCTGTGATCCAATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000321.1-829s1c1
Sequence:CCGGCCTCCCATGTTGCTCAAAGAACTCGAGTTCTTTGAGCAACATGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000321.2-1516s21c1
Sequence:CCGGTCGCTTGTATTACCGAGTAATCTCGAGATTACTCGGTAATACAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-1630s21c1
Sequence:CCGGGTGCGCTCTTGAGGTTGTAATCTCGAGATTACAACCTCAAGAGCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-4612s21c1
Sequence:CCGGCAGAGATCGTGTATTGAGATTCTCGAGAATCTCAATACACGATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288710    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-4103s21c1
Sequence:CCGGCCACATTATTTCTAGTCCAAACTCGAGTTTGGACTAGAAATAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_000321.2-2878s21c1
Sequence:CCGGGACTTCTACTCGAACACGAATCTCGAGATTCGTGTTCGAGTAGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009029
VALIDATED
RB1 MISSION shRNA Bacterial Glycerol Stock
retinoblastoma 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2108s1c1
Sequence:CCGGGCACATCATCTGGACTCTGTTCTCGAGAACAGAGTCCAGATGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009029.2-549s21c1
Sequence:GTACCGGTACCAGTACCAAGGTTGATAACTCGAGTTATCAACCTTGGTACTGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-213s1c1
Sequence:CCGGGCCAGGCTTGAGTTTGAAGAACTCGAGTTCTTCAAACTCAAGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009029.1-2043s1c1
Sequence:CCGGCGTCTAGCATATCTCCGACTACTCGAGTAGTCGGAGATATGCTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1038s1c1
Sequence:CCGGCGCTATGAAGAAGTTTATCTTCTCGAGAAGATAAACTTCTTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1430s1c1
Sequence:CCGGCCGATTGTATTACCGTGTGATCTCGAGATCACACGGTAATACAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2794s1c1
Sequence:CCGGCCACTCGAACACGAATGCAAACTCGAGTTTGCATTCGTGTTCGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1623s1c1
Sequence:CCGGCCGTGGATTCTGAACGTACTTCTCGAGAAGTACGTTCAGAATCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2757s1c1
Sequence:CCGGGAGTCCAAATTCCAACAGAAACTCGAGTTTCTGTTGGAATTTGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2168s1c1
Sequence:CCGGCCGACATTTGGACCAGATTATCTCGAGATAATCTGGTCCAAATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-613s1c1
Sequence:CCGGGCAGTGCGTTATCTACTGAAACTCGAGTTTCAGTAGATAACGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-1677s21c1
Sequence:GTACCGGGTGGATTCTGAACGTACTTAACTCGAGTTAAGTACGTTCAGAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-3980s21c1
Sequence:CCGGTAAGCCAATCTGGTCTAATAACTCGAGTTATTAGACCAGATTGGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-1452s21c1
Sequence:CCGGCATCGGAGTACAGCGATATAACTCGAGTTATATCGCTGTACTCCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-2099s21c1
Sequence:CCGGTAGCATATCTCCGACTAAATACTCGAGTATTTAGTCGGAGATATGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009029
VALIDATED
RB1 MISSION shRNA shRNA Plasmid DNA
retinoblastoma 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2108s1c1
Sequence:CCGGGCACATCATCTGGACTCTGTTCTCGAGAACAGAGTCCAGATGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009029.2-549s21c1
Sequence:GTACCGGTACCAGTACCAAGGTTGATAACTCGAGTTATCAACCTTGGTACTGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-213s1c1
Sequence:CCGGGCCAGGCTTGAGTTTGAAGAACTCGAGTTCTTCAAACTCAAGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009029.1-2043s1c1
Sequence:CCGGCGTCTAGCATATCTCCGACTACTCGAGTAGTCGGAGATATGCTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1038s1c1
Sequence:CCGGCGCTATGAAGAAGTTTATCTTCTCGAGAAGATAAACTTCTTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1430s1c1
Sequence:CCGGCCGATTGTATTACCGTGTGATCTCGAGATCACACGGTAATACAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2794s1c1
Sequence:CCGGCCACTCGAACACGAATGCAAACTCGAGTTTGCATTCGTGTTCGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1623s1c1
Sequence:CCGGCCGTGGATTCTGAACGTACTTCTCGAGAAGTACGTTCAGAATCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2757s1c1
Sequence:CCGGGAGTCCAAATTCCAACAGAAACTCGAGTTTCTGTTGGAATTTGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2168s1c1
Sequence:CCGGCCGACATTTGGACCAGATTATCTCGAGATAATCTGGTCCAAATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-613s1c1
Sequence:CCGGGCAGTGCGTTATCTACTGAAACTCGAGTTTCAGTAGATAACGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-1677s21c1
Sequence:GTACCGGGTGGATTCTGAACGTACTTAACTCGAGTTAAGTACGTTCAGAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-3980s21c1
Sequence:CCGGTAAGCCAATCTGGTCTAATAACTCGAGTTATTAGACCAGATTGGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-1452s21c1
Sequence:CCGGCATCGGAGTACAGCGATATAACTCGAGTTATATCGCTGTACTCCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-2099s21c1
Sequence:CCGGTAGCATATCTCCGACTAAATACTCGAGTATTTAGTCGGAGATATGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009029
VALIDATED
RB1 MISSION shRNA Lentiviral Transduction Particles
retinoblastoma 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2108s1c1
Sequence:CCGGGCACATCATCTGGACTCTGTTCTCGAGAACAGAGTCCAGATGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009029.2-549s21c1
Sequence:GTACCGGTACCAGTACCAAGGTTGATAACTCGAGTTATCAACCTTGGTACTGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-213s1c1
Sequence:CCGGGCCAGGCTTGAGTTTGAAGAACTCGAGTTCTTCAAACTCAAGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009029.1-2043s1c1
Sequence:CCGGCGTCTAGCATATCTCCGACTACTCGAGTAGTCGGAGATATGCTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1038s1c1
Sequence:CCGGCGCTATGAAGAAGTTTATCTTCTCGAGAAGATAAACTTCTTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1430s1c1
Sequence:CCGGCCGATTGTATTACCGTGTGATCTCGAGATCACACGGTAATACAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2794s1c1
Sequence:CCGGCCACTCGAACACGAATGCAAACTCGAGTTTGCATTCGTGTTCGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-1623s1c1
Sequence:CCGGCCGTGGATTCTGAACGTACTTCTCGAGAAGTACGTTCAGAATCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2757s1c1
Sequence:CCGGGAGTCCAAATTCCAACAGAAACTCGAGTTTCTGTTGGAATTTGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-2168s1c1
Sequence:CCGGCCGACATTTGGACCAGATTATCTCGAGATAATCTGGTCCAAATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009029.1-613s1c1
Sequence:CCGGGCAGTGCGTTATCTACTGAAACTCGAGTTTCAGTAGATAACGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-1677s21c1
Sequence:GTACCGGGTGGATTCTGAACGTACTTAACTCGAGTTAAGTACGTTCAGAATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-3980s21c1
Sequence:CCGGTAAGCCAATCTGGTCTAATAACTCGAGTTATTAGACCAGATTGGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-1452s21c1
Sequence:CCGGCATCGGAGTACAGCGATATAACTCGAGTTATATCGCTGTACTCCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_009029.2-2099s21c1
Sequence:CCGGTAGCATATCTCCGACTAAATACTCGAGTATTTAGTCGGAGATATGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)