EMAIL THIS PAGE TO A FRIEND

RBAK

RB-associated KRAB zinc finger

71 Gene Product Result for
Synonyms: ZNF769
UniProtKB ID: Q9NYW8, A6NDF2, A8KAK4, B2RN44, B9EGS1, F8W6M7
Gene ID:
Human(57786) Summary: This gene encodes a nuclear protein which interacts with the tumor suppressor retinoblastoma 1. The two interacting proteins are thought to act as a transcriptional repressor for promoters which are activated by the E2F1 transcription factor. This protein contains a Kruppel-associated box (KRAB), which is a transcriptional repressor motif. Read-through transcripts that include exons from the downstream gene LOC389458 are expressed from this locus. [provided by RefSeq, Mar 2011]
Mouse(57782) RB-associated KRAB repressor
Rat(288489) RB-associated KRAB zinc finger
dog(489877) RB-associated KRAB zinc finger
domestic cat(101099516) RB-associated KRAB zinc finger
cow(789791) RB-associated KRAB zinc finger
sheep(101117386) RB-associated KRAB zinc finger
naked mole-rat(101714002) RB-associated KRAB zinc finger
domestic guinea pig(100729541) RB-associated KRAB zinc finger
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021163 Rosetta Predictions human pricing
XM_001072631 Rosetta Predictions rat pricing
XM_221920 Rosetta Predictions rat pricing
NM_001045482 Rosetta Predictions mouse pricing
NM_021326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354714 predicted 1733
2 SASI_Hs02_00354715 predicted 1428
3 SASI_Hs02_00354716 predicted 1510
4 SASI_Hs02_00354717 predicted 2628
5 SASI_Hs01_00212542 predicted 1646
6 SASI_Hs02_00354718 predicted 1927
7 SASI_Hs01_00212543 predicted 1986
8 SASI_Hs01_00212546 predicted 1841
9 SASI_Hs01_00212547 predicted 2623
10 SASI_Hs02_00354719 predicted 1219
11 SASI_Hs01_00212541 predicted 939
12 SASI_Hs01_00212544 predicted 2165
13 SASI_Hs01_00212545 predicted 2447
14 SASI_Hs01_00212548 predicted 1230
15 SASI_Hs01_00212549 predicted 2148
16 SASI_Hs01_00212550 predicted 2151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339991 predicted 928
2 SASI_Rn02_00339992 predicted 1362
3 SASI_Rn02_00339993 predicted 1834
4 SASI_Rn02_00339994 predicted 707
5 SASI_Rn02_00339995 predicted 724
6 SASI_Rn02_00339996 predicted 800
7 SASI_Rn02_00339997 predicted 593
8 SASI_Rn02_00339998 predicted 1964
9 SASI_Rn02_00339999 predicted 891
10 SASI_Rn02_00340000 predicted 1651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380438 predicted 1133
2 SASI_Rn02_00380439 predicted 1557
3 SASI_Rn02_00380440 predicted 2030
4 SASI_Rn02_00380441 predicted 1521
5 SASI_Rn02_00380442 predicted 909
6 SASI_Rn02_00380443 predicted 923
7 SASI_Rn02_00380444 predicted 1005
8 SASI_Rn02_00380445 predicted 794
9 SASI_Rn02_00380446 predicted 2161
10 SASI_Rn02_00380447 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291464 predicted 992
2 SASI_Mm02_00291465 predicted 1438
3 SASI_Mm02_00291466 predicted 951
4 SASI_Mm02_00291467 predicted 1134
5 SASI_Mm02_00291468 predicted 863
6 SASI_Mm02_00291469 predicted 519
7 SASI_Mm02_00291470 predicted 1158
8 SASI_Mm02_00291471 predicted 2115
9 SASI_Mm02_00291472 predicted 677
10 SASI_Mm02_00291473 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325892 predicted 1091
2 SASI_Mm02_00325893 predicted 1543
3 SASI_Mm02_00325894 predicted 1050
4 SASI_Mm02_00325895 predicted 1236
5 SASI_Mm02_00325896 predicted 960
6 SASI_Mm02_00325897 predicted 624
7 SASI_Mm02_00325898 predicted 1260
8 SASI_Mm02_00325899 predicted 2217
9 SASI_Mm02_00325900 predicted 777
10 SASI_Mm02_00325901 predicted 492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021163
VALIDATED
RBAK MISSION shRNA Bacterial Glycerol Stock
RB-associated KRAB zinc finger
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-897s21c1
Sequence:CCGGCCTTGTTCCTTCAAGCATAATCTCGAGATTATGCTTGAAGGAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1930s1c1
Sequence:CCGGGCCTTCATTAGACATCGGAAACTCGAGTTTCCGATGTCTAATGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-651s21c1
Sequence:CCGGAGTTTCTGTGGGATATGATACCTCGAGGTATCATATCCCACAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-823s1c1
Sequence:CCGGGCTGCTTGTATCAATAGCAAACTCGAGTTTGCTATTGATACAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1157s1c1
Sequence:CCGGCCTTAGACAATGAGGCTGTTTCTCGAGAAACAGCCTCATTGTCTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1837s1c1
Sequence:CCGGCGGGTGTCATACCTCACTATACTCGAGTATAGTGAGGTATGACACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-2015s1c1
Sequence:CCGGCCGACCATCATACAGCTCATTCTCGAGAATGAGCTGTATGATGGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-2162s21c1
Sequence:CCGGTCAATGAGTTGTCATACTATACTCGAGTATAGTATGACAACTCATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-3596s21c1
Sequence:CCGGGTGTGCCTAGTGCCAATATTTCTCGAGAAATATTGGCACTAGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021163.3-2007s21c1
Sequence:CCGGGTATCTCACCGACCATCATACCTCGAGGTATGATGGTCGGTGAGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021163
VALIDATED
RBAK MISSION shRNA shRNA Plasmid DNA
RB-associated KRAB zinc finger
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-897s21c1
Sequence:CCGGCCTTGTTCCTTCAAGCATAATCTCGAGATTATGCTTGAAGGAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1930s1c1
Sequence:CCGGGCCTTCATTAGACATCGGAAACTCGAGTTTCCGATGTCTAATGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-651s21c1
Sequence:CCGGAGTTTCTGTGGGATATGATACCTCGAGGTATCATATCCCACAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-823s1c1
Sequence:CCGGGCTGCTTGTATCAATAGCAAACTCGAGTTTGCTATTGATACAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1157s1c1
Sequence:CCGGCCTTAGACAATGAGGCTGTTTCTCGAGAAACAGCCTCATTGTCTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1837s1c1
Sequence:CCGGCGGGTGTCATACCTCACTATACTCGAGTATAGTGAGGTATGACACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-2015s1c1
Sequence:CCGGCCGACCATCATACAGCTCATTCTCGAGAATGAGCTGTATGATGGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-2162s21c1
Sequence:CCGGTCAATGAGTTGTCATACTATACTCGAGTATAGTATGACAACTCATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-3596s21c1
Sequence:CCGGGTGTGCCTAGTGCCAATATTTCTCGAGAAATATTGGCACTAGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021163.3-2007s21c1
Sequence:CCGGGTATCTCACCGACCATCATACCTCGAGGTATGATGGTCGGTGAGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021163
VALIDATED
RBAK MISSION shRNA Lentiviral Transduction Particles
RB-associated KRAB zinc finger
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-897s21c1
Sequence:CCGGCCTTGTTCCTTCAAGCATAATCTCGAGATTATGCTTGAAGGAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1930s1c1
Sequence:CCGGGCCTTCATTAGACATCGGAAACTCGAGTTTCCGATGTCTAATGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-651s21c1
Sequence:CCGGAGTTTCTGTGGGATATGATACCTCGAGGTATCATATCCCACAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-823s1c1
Sequence:CCGGGCTGCTTGTATCAATAGCAAACTCGAGTTTGCTATTGATACAAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1157s1c1
Sequence:CCGGCCTTAGACAATGAGGCTGTTTCTCGAGAAACAGCCTCATTGTCTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-1837s1c1
Sequence:CCGGCGGGTGTCATACCTCACTATACTCGAGTATAGTGAGGTATGACACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021163.2-2015s1c1
Sequence:CCGGCCGACCATCATACAGCTCATTCTCGAGAATGAGCTGTATGATGGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-2162s21c1
Sequence:CCGGTCAATGAGTTGTCATACTATACTCGAGTATAGTATGACAACTCATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_021163.3-3596s21c1
Sequence:CCGGGTGTGCCTAGTGCCAATATTTCTCGAGAAATATTGGCACTAGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021163.3-2007s21c1
Sequence:CCGGGTATCTCACCGACCATCATACCTCGAGGTATGATGGTCGGTGAGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021326
RBAK MISSION shRNA Bacterial Glycerol Stock
RB-associated KRAB zinc finger
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021326.2-1061s21c1
Sequence:CCGGATGTCGGACTTCAGTACATATCTCGAGATATGTACTGAAGTCCGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1228s1c1
Sequence:CCGGCGCTTGTAGTGTGTGTGGAAACTCGAGTTTCCACACACACTACAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021326.1-3102s1c1
Sequence:CCGGGCCATATTTCTGACCGACGTTCTCGAGAACGTCGGTCAGAAATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-999s1c1
Sequence:CCGGCCTTAGACAGTGAAAGTGTTTCTCGAGAAACACTTTCACTGTCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1756s1c1
Sequence:CCGGCTTCAATCTAAACTCTGCTTTCTCGAGAAAGCAGAGTTTAGATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1706s1c1
Sequence:CCGGCGGAGCCATTTAGAAGAGAAACTCGAGTTTCTCTTCTAAATGGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021326.2-609s21c1
Sequence:CCGGTTGAGGAAATTGGCGAGAAACCTCGAGGTTTCTCGCCAATTTCCTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021326
RBAK MISSION shRNA shRNA Plasmid DNA
RB-associated KRAB zinc finger
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021326.2-1061s21c1
Sequence:CCGGATGTCGGACTTCAGTACATATCTCGAGATATGTACTGAAGTCCGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1228s1c1
Sequence:CCGGCGCTTGTAGTGTGTGTGGAAACTCGAGTTTCCACACACACTACAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021326.1-3102s1c1
Sequence:CCGGGCCATATTTCTGACCGACGTTCTCGAGAACGTCGGTCAGAAATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-999s1c1
Sequence:CCGGCCTTAGACAGTGAAAGTGTTTCTCGAGAAACACTTTCACTGTCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1756s1c1
Sequence:CCGGCTTCAATCTAAACTCTGCTTTCTCGAGAAAGCAGAGTTTAGATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1706s1c1
Sequence:CCGGCGGAGCCATTTAGAAGAGAAACTCGAGTTTCTCTTCTAAATGGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021326.2-609s21c1
Sequence:CCGGTTGAGGAAATTGGCGAGAAACCTCGAGGTTTCTCGCCAATTTCCTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021326
RBAK MISSION shRNA Lentiviral Transduction Particles
RB-associated KRAB zinc finger
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021326.2-1061s21c1
Sequence:CCGGATGTCGGACTTCAGTACATATCTCGAGATATGTACTGAAGTCCGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1228s1c1
Sequence:CCGGCGCTTGTAGTGTGTGTGGAAACTCGAGTTTCCACACACACTACAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021326.1-3102s1c1
Sequence:CCGGGCCATATTTCTGACCGACGTTCTCGAGAACGTCGGTCAGAAATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-999s1c1
Sequence:CCGGCCTTAGACAGTGAAAGTGTTTCTCGAGAAACACTTTCACTGTCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1756s1c1
Sequence:CCGGCTTCAATCTAAACTCTGCTTTCTCGAGAAAGCAGAGTTTAGATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021326.1-1706s1c1
Sequence:CCGGCGGAGCCATTTAGAAGAGAAACTCGAGTTTCTCTTCTAAATGGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021326.2-609s21c1
Sequence:CCGGTTGAGGAAATTGGCGAGAAACCTCGAGGTTTCTCGCCAATTTCCTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)