EMAIL THIS PAGE TO A FRIEND

RBBP7

retinoblastoma binding protein 7

114 Gene Product Result for
Synonyms: RbAp46
UniProtKB ID: Q16576, Q5JP00
Gene ID:
Human(5931) Summary: This protein is a ubiquitously expressed nuclear protein and belongs to a highly conserved subfamily of WD-repeat proteins. It is found among several proteins that binds directly to retinoblastoma protein, which regulates cell proliferation. The encoded protein is found in many histone deacetylase complexes, including mSin3 co-repressor complex. It is also present in protein complexes involved in chromatin assembly. This protein can interact with BRCA1 tumor-suppressor gene and may have a role in the regulation of cell proliferation and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(245688) retinoblastoma binding protein 7
Rat(83712) retinoblastoma binding protein 7
chicken(395390) retinoblastoma binding protein 7
Horse(100056761) retinoblastoma binding protein 7
domestic cat(101098198) retinoblastoma binding protein 7
dog(480854) retinoblastoma binding protein 7
cow(537402) retinoblastoma binding protein 7
sheep(101106657) retinoblastoma binding protein 7
naked mole-rat(101706465) retinoblastoma binding protein 7
Domestic Rabbit(100352868) retinoblastoma binding protein 7
domestic guinea pig(100716690) retinoblastoma binding protein 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R4279 Anti-RbAp46, C-terminal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
R4154 Anti-RbAp46, N-terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
R3779 Anti-RbAp48/RbAp46 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, microarray, western blot pricing
SAB2104734 Anti-RBBP7 antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, rat, horse, guinea pig
western blot pricing
SAB2104852 Anti-RBBP7, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rat, mouse, horse, rabbit, guinea pig
western blot pricing
PLA0158 Rabbit anti-RbBP7 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, human, rat, mouse, dog, primate, rabbit, ferret, guinea pig, marmoset, rhesus monkey, pig
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002893 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002893 Rosetta Predictions human pricing
NM_031816 Rosetta Predictions rat pricing
NM_009031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116835 predicted 1214
2 SASI_Hs01_00116836 predicted 667
3 SASI_Hs01_00116838 predicted 1002
4 SASI_Hs01_00116839 predicted 771
5 SASI_Hs01_00116841 predicted 1173
6 SASI_Hs01_00116842 predicted 354
7 SASI_Hs01_00116843 predicted 495
8 SASI_Hs01_00116844 predicted 1109
9 SASI_Hs02_00334697 predicted 651
10 SASI_Hs02_00334698 predicted 1101
11 SASI_Hs01_00116837 predicted 1482
12 SASI_Hs01_00116840 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080932 predicted 1068
2 SASI_Rn01_00080933 predicted 422
3 SASI_Rn02_00265285 predicted 273
4 SASI_Rn01_00080934 predicted 1555
5 SASI_Rn01_00080936 predicted 636
6 SASI_Rn02_00265286 predicted 275
7 SASI_Rn01_00080939 predicted 1428
8 SASI_Rn02_00265287 predicted 271
9 SASI_Rn01_00080940 predicted 440
10 SASI_Rn01_00080941 predicted 1592
11 SASI_Rn01_00080935 predicted 1540
12 SASI_Rn01_00080937 predicted 1554
13 SASI_Rn01_00080938 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315186 predicted 701
2 SASI_Mm01_00094032 predicted 1587
3 SASI_Mm01_00094033 predicted 321
4 SASI_Mm01_00094035 predicted 812
5 SASI_Mm01_00094036 predicted 564
6 SASI_Mm01_00094037 predicted 585
7 SASI_Mm01_00094038 predicted 1513
8 SASI_Mm01_00094039 predicted 692
9 SASI_Mm01_00094040 predicted 1635
10 SASI_Mm01_00094041 predicted 1087
11 SASI_Mm01_00094034 predicted 1057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009031
VALIDATED
RBBP7 MISSION shRNA Bacterial Glycerol Stock
retinoblastoma binding protein 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-1757s1c1
Sequence:CCGGCCTTTGATTCAACTGTCATTTCTCGAGAAATGACAGTTGAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-315s1c1
Sequence:CCGGCCGTTTCTGTATGACCTGGTTCTCGAGAACCAGGTCATACAGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009031.2-1251s1c1
Sequence:CCGGCGCCTGAATGTGTGGGATTTACTCGAGTAAATCCCACACATTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-272s1c1
Sequence:CCGGGCGTGTCATCAACGAAGAGTACTCGAGTACTCTTCGTTGATGACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-604s1c1
Sequence:CCGGGAGAAGTGAATCGTGCTCGTTCTCGAGAACGAGCACGATTCACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-359s21c1
Sequence:CCGGGCGTGTCATCAACGAAGAGTACTCGAGTACTCTTCGTTGATGACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009031.3-1844s21c1
Sequence:CCGGCCTTTGATTCAACTGTCATTTCTCGAGAAATGACAGTTGAATCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-691s21c1
Sequence:CCGGGAGAAGTGAATCGTGCTCGTTCTCGAGAACGAGCACGATTCACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-402s21c1
Sequence:CCGGCCGTTTCTGTATGACCTGGTTCTCGAGAACCAGGTCATACAGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-1338s21c1
Sequence:CCGGCGCCTGAATGTGTGGGATTTACTCGAGTAAATCCCACACATTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009031
VALIDATED
RBBP7 MISSION shRNA shRNA Plasmid DNA
retinoblastoma binding protein 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-1757s1c1
Sequence:CCGGCCTTTGATTCAACTGTCATTTCTCGAGAAATGACAGTTGAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-315s1c1
Sequence:CCGGCCGTTTCTGTATGACCTGGTTCTCGAGAACCAGGTCATACAGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009031.2-1251s1c1
Sequence:CCGGCGCCTGAATGTGTGGGATTTACTCGAGTAAATCCCACACATTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-272s1c1
Sequence:CCGGGCGTGTCATCAACGAAGAGTACTCGAGTACTCTTCGTTGATGACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-604s1c1
Sequence:CCGGGAGAAGTGAATCGTGCTCGTTCTCGAGAACGAGCACGATTCACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-359s21c1
Sequence:CCGGGCGTGTCATCAACGAAGAGTACTCGAGTACTCTTCGTTGATGACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009031.3-1844s21c1
Sequence:CCGGCCTTTGATTCAACTGTCATTTCTCGAGAAATGACAGTTGAATCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-691s21c1
Sequence:CCGGGAGAAGTGAATCGTGCTCGTTCTCGAGAACGAGCACGATTCACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-402s21c1
Sequence:CCGGCCGTTTCTGTATGACCTGGTTCTCGAGAACCAGGTCATACAGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-1338s21c1
Sequence:CCGGCGCCTGAATGTGTGGGATTTACTCGAGTAAATCCCACACATTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009031
VALIDATED
RBBP7 MISSION shRNA Lentiviral Transduction Particles
retinoblastoma binding protein 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039219    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-1757s1c1
Sequence:CCGGCCTTTGATTCAACTGTCATTTCTCGAGAAATGACAGTTGAATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-315s1c1
Sequence:CCGGCCGTTTCTGTATGACCTGGTTCTCGAGAACCAGGTCATACAGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009031.2-1251s1c1
Sequence:CCGGCGCCTGAATGTGTGGGATTTACTCGAGTAAATCCCACACATTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-272s1c1
Sequence:CCGGGCGTGTCATCAACGAAGAGTACTCGAGTACTCTTCGTTGATGACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009031.2-604s1c1
Sequence:CCGGGAGAAGTGAATCGTGCTCGTTCTCGAGAACGAGCACGATTCACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-359s21c1
Sequence:CCGGGCGTGTCATCAACGAAGAGTACTCGAGTACTCTTCGTTGATGACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009031.3-1844s21c1
Sequence:CCGGCCTTTGATTCAACTGTCATTTCTCGAGAAATGACAGTTGAATCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-691s21c1
Sequence:CCGGGAGAAGTGAATCGTGCTCGTTCTCGAGAACGAGCACGATTCACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-402s21c1
Sequence:CCGGCCGTTTCTGTATGACCTGGTTCTCGAGAACCAGGTCATACAGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009031.3-1338s21c1
Sequence:CCGGCGCCTGAATGTGTGGGATTTACTCGAGTAAATCCCACACATTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002893
VALIDATED
RBBP7 MISSION shRNA Bacterial Glycerol Stock
retinoblastoma binding protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002893.2-370s1c1
Sequence:CCGGCGTTTCTATATGACCTGGTTACTCGAGTAACCAGGTCATATAGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-327s1c1
Sequence:CCGGCGTGTCATCAATGAAGAATATCTCGAGATATTCTTCATTGATGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-1164s1c1
Sequence:CCGGGCGGATAAGACCGTAGCTTTACTCGAGTAAAGCTACGGTCTTATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-555s1c1
Sequence:CCGGGCACAGTTTGATGCTTCCCATCTCGAGATGGGAAGCATCAAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-1371s1c1
Sequence:CCGGCCTCCAGAACTCCTGTTTATTCTCGAGAATAAACAGGAGTTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002893.3-1672s21c1
Sequence:GTACCGGTGCTACATGAATGCTTGATTTCTCGAGAAATCAAGCATTCATGTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-398s21c1
Sequence:CCGGCGTGTCATCAATGAAGAATATCTCGAGATATTCTTCATTGATGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-1235s21c1
Sequence:CCGGGCGGATAAGACCGTAGCTTTACTCGAGTAAAGCTACGGTCTTATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-1442s21c1
Sequence:CCGGCCTCCAGAACTCCTGTTTATTCTCGAGAATAAACAGGAGTTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-626s21c1
Sequence:CCGGGCACAGTTTGATGCTTCCCATCTCGAGATGGGAAGCATCAAACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002893
VALIDATED
RBBP7 MISSION shRNA shRNA Plasmid DNA
retinoblastoma binding protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002893.2-370s1c1
Sequence:CCGGCGTTTCTATATGACCTGGTTACTCGAGTAACCAGGTCATATAGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-327s1c1
Sequence:CCGGCGTGTCATCAATGAAGAATATCTCGAGATATTCTTCATTGATGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-1164s1c1
Sequence:CCGGGCGGATAAGACCGTAGCTTTACTCGAGTAAAGCTACGGTCTTATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-555s1c1
Sequence:CCGGGCACAGTTTGATGCTTCCCATCTCGAGATGGGAAGCATCAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-1371s1c1
Sequence:CCGGCCTCCAGAACTCCTGTTTATTCTCGAGAATAAACAGGAGTTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002893.3-1672s21c1
Sequence:GTACCGGTGCTACATGAATGCTTGATTTCTCGAGAAATCAAGCATTCATGTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-398s21c1
Sequence:CCGGCGTGTCATCAATGAAGAATATCTCGAGATATTCTTCATTGATGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-1235s21c1
Sequence:CCGGGCGGATAAGACCGTAGCTTTACTCGAGTAAAGCTACGGTCTTATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-1442s21c1
Sequence:CCGGCCTCCAGAACTCCTGTTTATTCTCGAGAATAAACAGGAGTTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-626s21c1
Sequence:CCGGGCACAGTTTGATGCTTCCCATCTCGAGATGGGAAGCATCAAACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002893
VALIDATED
RBBP7 MISSION shRNA Lentiviral Transduction Particles
retinoblastoma binding protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002893.2-370s1c1
Sequence:CCGGCGTTTCTATATGACCTGGTTACTCGAGTAACCAGGTCATATAGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-327s1c1
Sequence:CCGGCGTGTCATCAATGAAGAATATCTCGAGATATTCTTCATTGATGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-1164s1c1
Sequence:CCGGGCGGATAAGACCGTAGCTTTACTCGAGTAAAGCTACGGTCTTATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-555s1c1
Sequence:CCGGGCACAGTTTGATGCTTCCCATCTCGAGATGGGAAGCATCAAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002893.2-1371s1c1
Sequence:CCGGCCTCCAGAACTCCTGTTTATTCTCGAGAATAAACAGGAGTTCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002893.3-1672s21c1
Sequence:GTACCGGTGCTACATGAATGCTTGATTTCTCGAGAAATCAAGCATTCATGTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-398s21c1
Sequence:CCGGCGTGTCATCAATGAAGAATATCTCGAGATATTCTTCATTGATGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-1235s21c1
Sequence:CCGGGCGGATAAGACCGTAGCTTTACTCGAGTAAAGCTACGGTCTTATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-1442s21c1
Sequence:CCGGCCTCCAGAACTCCTGTTTATTCTCGAGAATAAACAGGAGTTCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002893.3-626s21c1
Sequence:CCGGGCACAGTTTGATGCTTCCCATCTCGAGATGGGAAGCATCAAACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)