EMAIL THIS PAGE TO A FRIEND

RBBP8

retinoblastoma binding protein 8

196 Gene Product Result for
Synonyms: COM1 CTIP JWDS RIM SAE2 SCKL2
UniProtKB ID: Q99708, A6NKN2, A8K8W6, E7ETY1, O75371, Q8NHQ3
Gene ID:
Human(5932) Summary: The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]
Mouse(225182) retinoblastoma binding protein 8
Rat(291787) retinoblastoma binding protein 8
domestic guinea pig(100719710) retinoblastoma binding protein 8
Domestic Rabbit(100354690) retinoblastoma binding protein 8
naked mole-rat(101713602) retinoblastoma binding protein 8
cow(512977) retinoblastoma binding protein 8
sheep(101121816) retinoblastoma binding protein 8
Zebrafish(503536) retinoblastoma binding protein 8
domestic cat(101096268) retinoblastoma binding protein 8
dog(480175) retinoblastoma binding protein 8
chicken(421071) retinoblastoma binding protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002894 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_358326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070611 MISSION® esiRNA esiRNA human RBBP8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002894 Rosetta Predictions human pricing
NM_203291 Rosetta Predictions human pricing
NM_203292 Rosetta Predictions human pricing
NM_001134417 Rosetta Predictions rat pricing
NM_001081223 Rosetta Predictions mouse pricing
XM_484703 Rosetta Predictions mouse pricing
XM_886498 Rosetta Predictions mouse pricing
XM_896845 Rosetta Predictions mouse pricing
XM_896856 Rosetta Predictions mouse pricing
XM_896861 Rosetta Predictions mouse pricing
XM_896901 Rosetta Predictions mouse pricing
XM_977991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162597 predicted 966
2 SASI_Hs02_00334699 predicted 2100
3 SASI_Hs01_00162598 predicted 1005
4 SASI_Hs02_00334700 predicted 479
5 SASI_Hs01_00162599 predicted 897
6 SASI_Hs01_00162600 predicted 568
7 SASI_Hs01_00162601 predicted 802
8 SASI_Hs01_00162602 predicted 842
9 SASI_Hs01_00162603 predicted 1026
10 SASI_Hs01_00162604 predicted 490
11 SASI_Hs01_00162605 predicted 2046
12 SASI_Hs01_00162606 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176280 predicted 931
2 SASI_Hs02_00373209 predicted 2067
3 SASI_Hs01_00176281 predicted 975
4 SASI_Hs02_00373210 predicted 445
5 SASI_Hs01_00176282 predicted 862
6 SASI_Hs01_00176283 predicted 546
7 SASI_Hs01_00176284 predicted 768
8 SASI_Hs01_00176285 predicted 809
9 SASI_Hs01_00176286 predicted 990
10 SASI_Hs01_00176287 predicted 465
11 SASI_Hs01_00176288 predicted 2006
12 SASI_Hs01_00176289 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055672 predicted 1010
2 SASI_Hs02_00373211 predicted 2150
3 SASI_Hs01_00055673 predicted 1056
4 SASI_Hs02_00373212 predicted 950
5 SASI_Hs01_00055674 predicted 623
6 SASI_Hs01_00055675 predicted 848
7 SASI_Hs01_00055676 predicted 2376
8 SASI_Hs01_00055677 predicted 891
9 SASI_Hs01_00055678 predicted 1076
10 SASI_Hs01_00055679 predicted 547
11 SASI_Hs01_00055680 predicted 2096
12 SASI_Hs01_00055681 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256289 predicted 769
2 SASI_Rn02_00256290 predicted 2495
3 SASI_Rn02_00256291 predicted 2685
4 SASI_Rn02_00256292 predicted 283
5 SASI_Rn02_00256293 predicted 2658
6 SASI_Rn02_00256294 predicted 2788
7 SASI_Rn02_00256295 predicted 600
8 SASI_Rn02_00256296 predicted 1804
9 SASI_Rn02_00256297 predicted 2526
10 SASI_Rn02_00256298 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296391 predicted 734
2 SASI_Mm02_00296392 predicted 2630
3 SASI_Mm02_00296393 predicted 1977
4 SASI_Mm02_00296394 predicted 2761
5 SASI_Mm02_00296395 predicted 329
6 SASI_Mm02_00296396 predicted 1645
7 SASI_Mm02_00296397 predicted 2592
8 SASI_Mm02_00296398 predicted 2832
9 SASI_Mm02_00296399 predicted 2152
10 SASI_Mm02_00296400 predicted 2424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223982 predicted 1585
2 SASI_Mm01_00223983 predicted 747
3 SASI_Mm01_00223984 predicted 2630
4 SASI_Mm01_00223985 predicted 1985
5 SASI_Mm01_00223986 predicted 2763
6 SASI_Mm01_00223987 predicted 343
7 SASI_Mm01_00223988 predicted 1657
8 SASI_Mm01_00223989 predicted 2599
9 SASI_Mm01_00223990 predicted 2152
10 SASI_Mm01_00223991 predicted 2425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217507 predicted 1794
2 SASI_Mm01_00217508 predicted 961
3 SASI_Mm01_00217509 predicted 2842
4 SASI_Mm01_00217510 predicted 2204
5 SASI_Mm01_00217511 predicted 2982
6 SASI_Mm01_00217512 predicted 553
7 SASI_Mm01_00217513 predicted 1861
8 SASI_Mm01_00217514 predicted 2818
9 SASI_Mm01_00217515 predicted 2371
10 SASI_Mm01_00217516 predicted 2633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274048 predicted 1297
2 SASI_Mm01_00274049 predicted 471
3 SASI_Mm01_00274050 predicted 1276
4 SASI_Mm01_00274051 predicted 1360
5 SASI_Mm01_00274052 predicted 549
6 SASI_Mm01_00274053 predicted 1177
7 SASI_Mm01_00274054 predicted 1117
8 SASI_Mm01_00274055 predicted 835
9 SASI_Mm01_00274056 predicted 1289
10 SASI_Mm01_00274057 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209025 predicted 1794
2 SASI_Mm01_00209026 predicted 2007
3 SASI_Mm01_00209027 predicted 2075
4 SASI_Mm01_00209028 predicted 1998
5 SASI_Mm01_00209029 predicted 953
6 SASI_Mm01_00209030 predicted 553
7 SASI_Mm01_00209031 predicted 1868
8 SASI_Mm01_00209032 predicted 709
9 SASI_Mm01_00209033 predicted 2005
10 SASI_Mm01_00209034 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281929 predicted 1541
2 SASI_Mm01_00281930 predicted 1754
3 SASI_Mm01_00281931 predicted 1821
4 SASI_Mm01_00281932 predicted 1743
5 SASI_Mm01_00281933 predicted 2597
6 SASI_Mm01_00281934 predicted 1953
7 SASI_Mm01_00281935 predicted 2721
8 SASI_Mm01_00281936 predicted 1619
9 SASI_Mm01_00281937 predicted 2557
10 SASI_Mm01_00281938 predicted 2122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273948 predicted 1696
2 SASI_Mm01_00273949 predicted 863
3 SASI_Mm01_00273950 predicted 2744
4 SASI_Mm01_00273951 predicted 2101
5 SASI_Mm01_00273952 predicted 2883
6 SASI_Mm01_00273953 predicted 454
7 SASI_Mm01_00273954 predicted 1772
8 SASI_Mm01_00273955 predicted 373
9 SASI_Mm01_00273956 predicted 2716
10 SASI_Mm01_00273957 predicted 2268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216748 predicted 1505
2 SASI_Mm01_00216749 predicted 1718
3 SASI_Mm01_00216750 predicted 1790
4 SASI_Mm01_00216751 predicted 669
5 SASI_Mm01_00216752 predicted 2552
6 SASI_Mm01_00216753 predicted 1907
7 SASI_Mm01_00216754 predicted 2692
8 SASI_Mm01_00216755 predicted 1579
9 SASI_Mm01_00216756 predicted 2526
10 SASI_Mm01_00216757 predicted 2078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002894
VALIDATED
RBBP8 MISSION shRNA Bacterial Glycerol Stock
retinoblastoma binding protein 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-659s21c1
Sequence:CCGGCGGCAGCAGAATCTTAAACTTCTCGAGAAGTTTAAGATTCTGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-2972s21c1
Sequence:CCGGCGTCAGCCTTACAACGCAATACTCGAGTATTGCGTTGTAAGGCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002894.2-3041s21c1
Sequence:CCGGCAGAAGGATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATCCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-968s21c1
Sequence:CCGGCCACAACATAATCCTAATGAACTCGAGTTCATTAGGATTATGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-3008s1c1
Sequence:CCGGCAGAAGGATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATCCTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-626s1c1
Sequence:CCGGCGGCAGCAGAATCTTAAACTTCTCGAGAAGTTTAAGATTCTGCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002894.1-935s1c1
Sequence:CCGGCCACAACATAATCCTAATGAACTCGAGTTCATTAGGATTATGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-2939s1c1
Sequence:CCGGCGTCAGCCTTACAACGCAATACTCGAGTATTGCGTTGTAAGGCTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002894.1-2003s1c1
Sequence:CCGGCCAGACAATAAACCATCATTACTCGAGTAATGATGGTTTATTGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002894
VALIDATED
RBBP8 MISSION shRNA shRNA Plasmid DNA
retinoblastoma binding protein 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-659s21c1
Sequence:CCGGCGGCAGCAGAATCTTAAACTTCTCGAGAAGTTTAAGATTCTGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-2972s21c1
Sequence:CCGGCGTCAGCCTTACAACGCAATACTCGAGTATTGCGTTGTAAGGCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002894.2-3041s21c1
Sequence:CCGGCAGAAGGATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATCCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-968s21c1
Sequence:CCGGCCACAACATAATCCTAATGAACTCGAGTTCATTAGGATTATGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-3008s1c1
Sequence:CCGGCAGAAGGATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATCCTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-626s1c1
Sequence:CCGGCGGCAGCAGAATCTTAAACTTCTCGAGAAGTTTAAGATTCTGCTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002894.1-935s1c1
Sequence:CCGGCCACAACATAATCCTAATGAACTCGAGTTCATTAGGATTATGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-2939s1c1
Sequence:CCGGCGTCAGCCTTACAACGCAATACTCGAGTATTGCGTTGTAAGGCTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002894.1-2003s1c1
Sequence:CCGGCCAGACAATAAACCATCATTACTCGAGTAATGATGGTTTATTGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002894
VALIDATED
RBBP8 MISSION shRNA Lentiviral Transduction Particles
retinoblastoma binding protein 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-659s21c1
Sequence:CCGGCGGCAGCAGAATCTTAAACTTCTCGAGAAGTTTAAGATTCTGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-2972s21c1
Sequence:CCGGCGTCAGCCTTACAACGCAATACTCGAGTATTGCGTTGTAAGGCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002894.2-3041s21c1
Sequence:CCGGCAGAAGGATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATCCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002894.2-968s21c1
Sequence:CCGGCCACAACATAATCCTAATGAACTCGAGTTCATTAGGATTATGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-3008s1c1
Sequence:CCGGCAGAAGGATGAAGGACAGTTTCTCGAGAAACTGTCCTTCATCCTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-626s1c1
Sequence:CCGGCGGCAGCAGAATCTTAAACTTCTCGAGAAGTTTAAGATTCTGCTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002894.1-935s1c1
Sequence:CCGGCCACAACATAATCCTAATGAACTCGAGTTCATTAGGATTATGTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002894.1-2939s1c1
Sequence:CCGGCGTCAGCCTTACAACGCAATACTCGAGTATTGCGTTGTAAGGCTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002894.1-2003s1c1
Sequence:CCGGCCAGACAATAAACCATCATTACTCGAGTAATGATGGTTTATTGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081223
VALIDATED
RBBP8 MISSION shRNA Bacterial Glycerol Stock
retinoblastoma binding protein 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081223.1-3199s21c1
Sequence:CCGGACGGCTGTTGTAGTCTATAATCTCGAGATTATAGACTACAACAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-555s21c1
Sequence:CCGGATCCGACAGCAGAACCTTAAGCTCGAGCTTAAGGTTCTGCTGTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081223.1-2253s21c1
Sequence:CCGGGATAGCAGTCACTCACGATTACTCGAGTAATCGTGAGTGACTGCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-1772s21c1
Sequence:CCGGACTTAAGCAAGCCACTATTTACTCGAGTAAATAGTGGCTTGCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-335s21c1
Sequence:CCGGGCAAGGTTTACAAGTCAAAGTCTCGAGACTTTGACTTGTAAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081223
VALIDATED
RBBP8 MISSION shRNA shRNA Plasmid DNA
retinoblastoma binding protein 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081223.1-3199s21c1
Sequence:CCGGACGGCTGTTGTAGTCTATAATCTCGAGATTATAGACTACAACAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-555s21c1
Sequence:CCGGATCCGACAGCAGAACCTTAAGCTCGAGCTTAAGGTTCTGCTGTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081223.1-2253s21c1
Sequence:CCGGGATAGCAGTCACTCACGATTACTCGAGTAATCGTGAGTGACTGCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-1772s21c1
Sequence:CCGGACTTAAGCAAGCCACTATTTACTCGAGTAAATAGTGGCTTGCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-335s21c1
Sequence:CCGGGCAAGGTTTACAAGTCAAAGTCTCGAGACTTTGACTTGTAAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081223
VALIDATED
RBBP8 MISSION shRNA Lentiviral Transduction Particles
retinoblastoma binding protein 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081223.1-3199s21c1
Sequence:CCGGACGGCTGTTGTAGTCTATAATCTCGAGATTATAGACTACAACAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-555s21c1
Sequence:CCGGATCCGACAGCAGAACCTTAAGCTCGAGCTTAAGGTTCTGCTGTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081223.1-2253s21c1
Sequence:CCGGGATAGCAGTCACTCACGATTACTCGAGTAATCGTGAGTGACTGCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-1772s21c1
Sequence:CCGGACTTAAGCAAGCCACTATTTACTCGAGTAAATAGTGGCTTGCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081223.1-335s21c1
Sequence:CCGGGCAAGGTTTACAAGTCAAAGTCTCGAGACTTTGACTTGTAAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358326
VALIDATED
RBBP8 MISSION shRNA Bacterial Glycerol Stock
retinoblastoma binding protein 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358326.1-3426s1c1
Sequence:CCGGGCTTCCAGTTTAGGTGTTTATCTCGAGATAAACACCTAAACTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358326.1-429s1c1
Sequence:CCGGGCATCCAATGACTTCAAGGAACTCGAGTTCCTTGAAGTCATTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358326.1-765s1c1
Sequence:CCGGACCATGTGCTTAAAGCATAATCTCGAGATTATGCTTTAAGCACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358326.1-488s1c1
Sequence:CCGGGCAAGGTTTACAAGTCAAAGTCTCGAGACTTTGACTTGTAAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358326.1-740s1c1
Sequence:CCGGGCTGAGTGAGTTCCCTTTCATCTCGAGATGAAAGGGAACTCACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358326
VALIDATED
RBBP8 MISSION shRNA shRNA Plasmid DNA
retinoblastoma binding protein 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358326.1-3426s1c1
Sequence:CCGGGCTTCCAGTTTAGGTGTTTATCTCGAGATAAACACCTAAACTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358326.1-429s1c1
Sequence:CCGGGCATCCAATGACTTCAAGGAACTCGAGTTCCTTGAAGTCATTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358326.1-765s1c1
Sequence:CCGGACCATGTGCTTAAAGCATAATCTCGAGATTATGCTTTAAGCACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358326.1-488s1c1
Sequence:CCGGGCAAGGTTTACAAGTCAAAGTCTCGAGACTTTGACTTGTAAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358326.1-740s1c1
Sequence:CCGGGCTGAGTGAGTTCCCTTTCATCTCGAGATGAAAGGGAACTCACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358326
VALIDATED
RBBP8 MISSION shRNA Lentiviral Transduction Particles
retinoblastoma binding protein 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358326.1-3426s1c1
Sequence:CCGGGCTTCCAGTTTAGGTGTTTATCTCGAGATAAACACCTAAACTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358326.1-429s1c1
Sequence:CCGGGCATCCAATGACTTCAAGGAACTCGAGTTCCTTGAAGTCATTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358326.1-765s1c1
Sequence:CCGGACCATGTGCTTAAAGCATAATCTCGAGATTATGCTTTAAGCACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358326.1-488s1c1
Sequence:CCGGGCAAGGTTTACAAGTCAAAGTCTCGAGACTTTGACTTGTAAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358326.1-740s1c1
Sequence:CCGGGCTGAGTGAGTTCCCTTTCATCTCGAGATGAAAGGGAACTCACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)