EMAIL THIS PAGE TO A FRIEND

RBBP8NL

RBBP8 N-terminal like

29 Gene Product Result for
Synonyms: C20orf151
UniProtKB ID: Q8NC74, B2RP98, Q8N4Z9, Q9BR75, Q9H0Y9
Gene ID:
Mouse(271887) RBBP8 N-terminal like
domestic guinea pig(100719380) RBBP8 N-terminal like
naked mole-rat(101704158) RBBP8 N-terminal like
cow(515877) RBBP8 N-terminal like
sheep(101120938) RBBP8 N-terminal like
chicken(101666718) RBBP8 N-terminal like
domestic cat(101083416) RBBP8 N-terminal like
dog(485960) RBBP8 N-terminal like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080833 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080833 Rosetta Predictions human pricing
NM_173031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238126 predicted 1323
2 SASI_Hs02_00362623 predicted 2038
3 SASI_Hs01_00238127 predicted 2384
4 SASI_Hs01_00238128 predicted 1314
5 SASI_Hs01_00238129 predicted 1330
6 SASI_Hs01_00238130 predicted 1315
7 SASI_Hs01_00238131 predicted 1954
8 SASI_Hs01_00238132 predicted 2429
9 SASI_Hs01_00238133 predicted 1859
10 SASI_Hs01_00238134 predicted 1827
11 SASI_Hs01_00238125 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173775 predicted 988
2 SASI_Mm01_00173776 predicted 976
3 SASI_Mm01_00173777 predicted 687
4 SASI_Mm01_00173778 predicted 925
5 SASI_Mm01_00173779 predicted 243
6 SASI_Mm01_00173780 predicted 1590
7 SASI_Mm01_00173781 predicted 287
8 SASI_Mm01_00173782 predicted 1388
9 SASI_Mm01_00173783 predicted 1680
10 SASI_Mm01_00173784 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173031
RBBP8NL MISSION shRNA Bacterial Glycerol Stock
RBBP8 N-terminal like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173031.1-2124s1c1
Sequence:CCGGCCAAATGACCTCCTTGAGGTACTCGAGTACCTCAAGGAGGTCATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-243s1c1
Sequence:CCGGCTGCAGAACAAGCTTCTAGAACTCGAGTTCTAGAAGCTTGTTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-983s1c1
Sequence:CCGGCATAGCCTATGAGACCCTGAACTCGAGTTCAGGGTCTCATAGGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-1931s1c1
Sequence:CCGGCCAACAGAGTCAGCAACAGAACTCGAGTTCTGTTGCTGACTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-1595s1c1
Sequence:CCGGCAGCTCCCATACTCTCAGTAACTCGAGTTACTGAGAGTATGGGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173031
RBBP8NL MISSION shRNA shRNA Plasmid DNA
RBBP8 N-terminal like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173031.1-2124s1c1
Sequence:CCGGCCAAATGACCTCCTTGAGGTACTCGAGTACCTCAAGGAGGTCATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-243s1c1
Sequence:CCGGCTGCAGAACAAGCTTCTAGAACTCGAGTTCTAGAAGCTTGTTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-983s1c1
Sequence:CCGGCATAGCCTATGAGACCCTGAACTCGAGTTCAGGGTCTCATAGGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-1931s1c1
Sequence:CCGGCCAACAGAGTCAGCAACAGAACTCGAGTTCTGTTGCTGACTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-1595s1c1
Sequence:CCGGCAGCTCCCATACTCTCAGTAACTCGAGTTACTGAGAGTATGGGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173031
RBBP8NL MISSION shRNA Lentiviral Transduction Particles
RBBP8 N-terminal like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173031.1-2124s1c1
Sequence:CCGGCCAAATGACCTCCTTGAGGTACTCGAGTACCTCAAGGAGGTCATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-243s1c1
Sequence:CCGGCTGCAGAACAAGCTTCTAGAACTCGAGTTCTAGAAGCTTGTTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-983s1c1
Sequence:CCGGCATAGCCTATGAGACCCTGAACTCGAGTTCAGGGTCTCATAGGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-1931s1c1
Sequence:CCGGCCAACAGAGTCAGCAACAGAACTCGAGTTCTGTTGCTGACTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173031.1-1595s1c1
Sequence:CCGGCAGCTCCCATACTCTCAGTAACTCGAGTTACTGAGAGTATGGGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080833
RBBP8NL MISSION shRNA Bacterial Glycerol Stock
RBBP8 N-terminal like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080833.1-2642s1c1
Sequence:CCGGCCCGCCAAGCTCCAAGCACAACTCGAGTTGTGCTTGGAGCTTGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-490s1c1
Sequence:CCGGGAAGGAAGAGAACGAGACCTTCTCGAGAAGGTCTCGTTCTCTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-1737s1c1
Sequence:CCGGGCAGTACAGAAGATGAAGACACTCGAGTGTCTTCATCTTCTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-1456s1c1
Sequence:CCGGGCAGGACTGTGCCCTAGACAACTCGAGTTGTCTAGGGCACAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-463s1c1
Sequence:CCGGCATCCTCACCAACGAGATGAACTCGAGTTCATCTCGTTGGTGAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-1903s21c1
Sequence:CCGGAGTCCGACGAACTGGATGAGACTCGAGTCTCATCCAGTTCGTCGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-314s21c1
Sequence:CCGGGATCGAGGAGCTCTTCTCCAACTCGAGTTGGAGAAGAGCTCCTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-546s21c1
Sequence:CCGGACCTTGAAGGAGGAGGTGAAGCTCGAGCTTCACCTCCTCCTTCAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-266s21c1
Sequence:CCGGGAACAAGCTTCTGGAACTGAACTCGAGTTCAGTTCCAGAAGCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-1886s21c1
Sequence:CCGGTGAAGTGCTGAGACCAGAGTCCTCGAGGACTCTGGTCTCAGCACTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080833
RBBP8NL MISSION shRNA shRNA Plasmid DNA
RBBP8 N-terminal like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080833.1-2642s1c1
Sequence:CCGGCCCGCCAAGCTCCAAGCACAACTCGAGTTGTGCTTGGAGCTTGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-490s1c1
Sequence:CCGGGAAGGAAGAGAACGAGACCTTCTCGAGAAGGTCTCGTTCTCTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-1737s1c1
Sequence:CCGGGCAGTACAGAAGATGAAGACACTCGAGTGTCTTCATCTTCTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-1456s1c1
Sequence:CCGGGCAGGACTGTGCCCTAGACAACTCGAGTTGTCTAGGGCACAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-463s1c1
Sequence:CCGGCATCCTCACCAACGAGATGAACTCGAGTTCATCTCGTTGGTGAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-1903s21c1
Sequence:CCGGAGTCCGACGAACTGGATGAGACTCGAGTCTCATCCAGTTCGTCGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-314s21c1
Sequence:CCGGGATCGAGGAGCTCTTCTCCAACTCGAGTTGGAGAAGAGCTCCTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-546s21c1
Sequence:CCGGACCTTGAAGGAGGAGGTGAAGCTCGAGCTTCACCTCCTCCTTCAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-266s21c1
Sequence:CCGGGAACAAGCTTCTGGAACTGAACTCGAGTTCAGTTCCAGAAGCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-1886s21c1
Sequence:CCGGTGAAGTGCTGAGACCAGAGTCCTCGAGGACTCTGGTCTCAGCACTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080833
RBBP8NL MISSION shRNA Lentiviral Transduction Particles
RBBP8 N-terminal like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080833.1-2642s1c1
Sequence:CCGGCCCGCCAAGCTCCAAGCACAACTCGAGTTGTGCTTGGAGCTTGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-490s1c1
Sequence:CCGGGAAGGAAGAGAACGAGACCTTCTCGAGAAGGTCTCGTTCTCTTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-1737s1c1
Sequence:CCGGGCAGTACAGAAGATGAAGACACTCGAGTGTCTTCATCTTCTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-1456s1c1
Sequence:CCGGGCAGGACTGTGCCCTAGACAACTCGAGTTGTCTAGGGCACAGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080833.1-463s1c1
Sequence:CCGGCATCCTCACCAACGAGATGAACTCGAGTTCATCTCGTTGGTGAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-1903s21c1
Sequence:CCGGAGTCCGACGAACTGGATGAGACTCGAGTCTCATCCAGTTCGTCGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-314s21c1
Sequence:CCGGGATCGAGGAGCTCTTCTCCAACTCGAGTTGGAGAAGAGCTCCTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-546s21c1
Sequence:CCGGACCTTGAAGGAGGAGGTGAAGCTCGAGCTTCACCTCCTCCTTCAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-266s21c1
Sequence:CCGGGAACAAGCTTCTGGAACTGAACTCGAGTTCAGTTCCAGAAGCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080833.2-1886s21c1
Sequence:CCGGTGAAGTGCTGAGACCAGAGTCCTCGAGGACTCTGGTCTCAGCACTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)