EMAIL THIS PAGE TO A FRIEND

RBCK1

RanBP-type and C3HC4-type zinc finger containing 1

79 Gene Product Result for
Synonyms: C20orf18 HOIL-1 HOIL1 RBCK2 RNF54 UBCE7IP3 XAP3 XAP4 ZRANB4
UniProtKB ID: Q9BYM8, O95623, Q86SL2, Q96BS3, Q9BYM9
Gene ID:
Human(10616) Summary: The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(24105) RanBP-type and C3HC4-type zinc finger containing 1
Rat(60383) RanBP-type and C3HC4-type zinc finger containing 1
cow(504400) RanBP-type and C3HC4-type zinc finger containing 1
sheep(101122207) RanBP-type and C3HC4-type zinc finger containing 1
domestic guinea pig(100734748) RanBP-type and C3HC4-type zinc finger containing 1
naked mole-rat(101721667) RanBP-type and C3HC4-type zinc finger containing 1
Domestic Rabbit(100347560) RanBP-type and C3HC4-type zinc finger containing 1
Zebrafish(431715) RanBP-type and C3HC4-type zinc finger containing 1
domestic cat(101083505) RanBP-type and C3HC4-type zinc finger containing 1
dog(485818) RanBP-type and C3HC4-type zinc finger containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006462 Rosetta Predictions human pricing
NM_031229 Rosetta Predictions human pricing
NM_021764 Rosetta Predictions rat pricing
NM_001083921 Rosetta Predictions mouse pricing
NM_019705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127700 predicted 921
2 SASI_Hs02_00341614 predicted 1445
3 SASI_Hs01_00127701 predicted 1638
4 SASI_Hs01_00127703 predicted 1716
5 SASI_Hs01_00127704 predicted 1011
6 SASI_Hs01_00127707 predicted 1666
7 SASI_Hs02_00341615 predicted 1676
8 SASI_Hs02_00341616 predicted 1600
9 SASI_Hs02_00341617 predicted 1286
10 SASI_Hs02_00341618 predicted 2222
11 SASI_Hs01_00127698 predicted 2114
12 SASI_Hs01_00127699 predicted 2019
13 SASI_Hs01_00127702 predicted 1997
14 SASI_Hs01_00127705 predicted 1849
15 SASI_Hs01_00127706 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156539 predicted 1063
2 SASI_Hs02_00358639 predicted 1591
3 SASI_Hs01_00156540 predicted 1781
4 SASI_Hs01_00156542 predicted 1860
5 SASI_Hs01_00156543 predicted 1157
6 SASI_Hs01_00156546 predicted 1807
7 SASI_Hs02_00358640 predicted 1819
8 SASI_Hs02_00358641 predicted 1741
9 SASI_Hs02_00358642 predicted 1434
10 SASI_Hs02_00358643 predicted 2366
11 SASI_Hs01_00156537 predicted 2266
12 SASI_Hs01_00156538 predicted 2172
13 SASI_Hs01_00156541 predicted 2140
14 SASI_Hs01_00156544 predicted 1996
15 SASI_Hs01_00156545 predicted 1943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094099 predicted 354
2 SASI_Rn01_00094100 predicted 1503
3 SASI_Rn01_00094101 predicted 1446
4 SASI_Rn01_00094102 predicted 1024
5 SASI_Rn01_00094103 predicted 538
6 SASI_Rn01_00094104 predicted 760
7 SASI_Rn01_00094106 predicted 1698
8 SASI_Rn01_00094107 predicted 653
9 SASI_Rn02_00262824 predicted 549
10 SASI_Rn02_00262825 predicted 1370
11 SASI_Rn01_00094105 predicted 635
12 SASI_Rn01_00094108 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300006 predicted 2131
2 SASI_Mm02_00300007 predicted 2031
3 SASI_Mm02_00300008 predicted 617
4 SASI_Mm02_00300009 predicted 1525
5 SASI_Mm02_00300010 predicted 525
6 SASI_Mm02_00300011 predicted 724
7 SASI_Mm02_00300012 predicted 1577
8 SASI_Mm02_00300013 predicted 1774
9 SASI_Mm02_00300014 predicted 2007
10 SASI_Mm02_00300015 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027763 predicted 1974
2 SASI_Mm01_00027765 predicted 1867
3 SASI_Mm01_00027766 predicted 449
4 SASI_Mm01_00027767 predicted 1357
5 SASI_Mm01_00027768 predicted 361
6 SASI_Mm01_00027769 predicted 567
7 SASI_Mm01_00027770 predicted 1423
8 SASI_Mm01_00027771 predicted 1612
9 SASI_Mm01_00027772 predicted 1847
10 SASI_Mm02_00324811 predicted 1491
11 SASI_Mm01_00027764 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006462
VALIDATED
RBCK1 MISSION shRNA Bacterial Glycerol Stock
RanBP-type and C3HC4-type zinc finger containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-728s1c1
Sequence:CCGGGCCCTGATATGACAGTGGCGTCTCGAGACGCCACTGTCATATCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006462.2-2327s1c1
Sequence:CCGGCCACAACACTCATCTGTCAAACTCGAGTTTGACAGATGAGTGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-1722s1c1
Sequence:CCGGGCAGATGAACTGCAAGGAGTACTCGAGTACTCCTTGCAGTTCATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006462.2-1539s1c1
Sequence:CCGGCCCTGAGGATTACCAGCGATTCTCGAGAATCGCTGGTAATCCTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-1985s1c1
Sequence:CCGGGCAGGGTAAATGGGATTCCTTCTCGAGAAGGAATCCCATTTACCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006462
VALIDATED
RBCK1 MISSION shRNA shRNA Plasmid DNA
RanBP-type and C3HC4-type zinc finger containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-728s1c1
Sequence:CCGGGCCCTGATATGACAGTGGCGTCTCGAGACGCCACTGTCATATCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006462.2-2327s1c1
Sequence:CCGGCCACAACACTCATCTGTCAAACTCGAGTTTGACAGATGAGTGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-1722s1c1
Sequence:CCGGGCAGATGAACTGCAAGGAGTACTCGAGTACTCCTTGCAGTTCATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006462.2-1539s1c1
Sequence:CCGGCCCTGAGGATTACCAGCGATTCTCGAGAATCGCTGGTAATCCTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-1985s1c1
Sequence:CCGGGCAGGGTAAATGGGATTCCTTCTCGAGAAGGAATCCCATTTACCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006462
VALIDATED
RBCK1 MISSION shRNA Lentiviral Transduction Particles
RanBP-type and C3HC4-type zinc finger containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-728s1c1
Sequence:CCGGGCCCTGATATGACAGTGGCGTCTCGAGACGCCACTGTCATATCAGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006462.2-2327s1c1
Sequence:CCGGCCACAACACTCATCTGTCAAACTCGAGTTTGACAGATGAGTGTTGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-1722s1c1
Sequence:CCGGGCAGATGAACTGCAAGGAGTACTCGAGTACTCCTTGCAGTTCATCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006462.2-1539s1c1
Sequence:CCGGCCCTGAGGATTACCAGCGATTCTCGAGAATCGCTGGTAATCCTCAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000007600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006462.2-1985s1c1
Sequence:CCGGGCAGGGTAAATGGGATTCCTTCTCGAGAAGGAATCCCATTTACCCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019705
VALIDATED
RBCK1 MISSION shRNA Bacterial Glycerol Stock
RanBP-type and C3HC4-type zinc finger containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1689s21c1
Sequence:CCGGGCCGGGTCAATGGGATTCCATCTCGAGATGGAATCCCATTGACCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-869s1c1
Sequence:CCGGCCTACCAGATACCTGCTTCATCTCGAGATGAAGCAGGTATCTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-452s1c1
Sequence:CCGGCCTCCCTTAAGGACATGGTATCTCGAGATACCATGTCCTTAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1685s1c1
Sequence:CCGGGCCGGGTCAATGGGATTCCATCTCGAGATGGAATCCCATTGACCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1488s1c1
Sequence:CCGGGCAGACGACAGAGATGCTAAACTCGAGTTTAGCATCTCTGTCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1422s1c1
Sequence:CCGGGCACATGAATTGCAGGGAGTACTCGAGTACTCCCTGCAATTCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1492s21c1
Sequence:CCGGGCAGACGACAGAGATGCTAAACTCGAGTTTAGCATCTCTGTCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1426s21c1
Sequence:CCGGGCACATGAATTGCAGGGAGTACTCGAGTACTCCCTGCAATTCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-873s21c1
Sequence:CCGGCCTACCAGATACCTGCTTCATCTCGAGATGAAGCAGGTATCTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019705
VALIDATED
RBCK1 MISSION shRNA shRNA Plasmid DNA
RanBP-type and C3HC4-type zinc finger containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1689s21c1
Sequence:CCGGGCCGGGTCAATGGGATTCCATCTCGAGATGGAATCCCATTGACCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-869s1c1
Sequence:CCGGCCTACCAGATACCTGCTTCATCTCGAGATGAAGCAGGTATCTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-452s1c1
Sequence:CCGGCCTCCCTTAAGGACATGGTATCTCGAGATACCATGTCCTTAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1685s1c1
Sequence:CCGGGCCGGGTCAATGGGATTCCATCTCGAGATGGAATCCCATTGACCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1488s1c1
Sequence:CCGGGCAGACGACAGAGATGCTAAACTCGAGTTTAGCATCTCTGTCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1422s1c1
Sequence:CCGGGCACATGAATTGCAGGGAGTACTCGAGTACTCCCTGCAATTCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1492s21c1
Sequence:CCGGGCAGACGACAGAGATGCTAAACTCGAGTTTAGCATCTCTGTCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1426s21c1
Sequence:CCGGGCACATGAATTGCAGGGAGTACTCGAGTACTCCCTGCAATTCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-873s21c1
Sequence:CCGGCCTACCAGATACCTGCTTCATCTCGAGATGAAGCAGGTATCTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019705
VALIDATED
RBCK1 MISSION shRNA Lentiviral Transduction Particles
RanBP-type and C3HC4-type zinc finger containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1689s21c1
Sequence:CCGGGCCGGGTCAATGGGATTCCATCTCGAGATGGAATCCCATTGACCCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-869s1c1
Sequence:CCGGCCTACCAGATACCTGCTTCATCTCGAGATGAAGCAGGTATCTGGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-452s1c1
Sequence:CCGGCCTCCCTTAAGGACATGGTATCTCGAGATACCATGTCCTTAAGGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1685s1c1
Sequence:CCGGGCCGGGTCAATGGGATTCCATCTCGAGATGGAATCCCATTGACCCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1488s1c1
Sequence:CCGGGCAGACGACAGAGATGCTAAACTCGAGTTTAGCATCTCTGTCGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019705.2-1422s1c1
Sequence:CCGGGCACATGAATTGCAGGGAGTACTCGAGTACTCCCTGCAATTCATGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1492s21c1
Sequence:CCGGGCAGACGACAGAGATGCTAAACTCGAGTTTAGCATCTCTGTCGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000316811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-1426s21c1
Sequence:CCGGGCACATGAATTGCAGGGAGTACTCGAGTACTCCCTGCAATTCATGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000316812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019705.3-873s21c1
Sequence:CCGGCCTACCAGATACCTGCTTCATCTCGAGATGAAGCAGGTATCTGGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???