EMAIL THIS PAGE TO A FRIEND

RBFOX1

RNA binding protein, fox-1 homolog (C. elegans) 1

199 Gene Product Result for
Synonyms: 2BP1 A2BP1 FOX-1 FOX1 HRNBP1
UniProtKB ID: Q9NWB1, Q7Z7I7, Q8TAE3, Q8TAF2, Q8WYB2, Q9NS20
Gene ID:
Human(54715) Summary: The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(268859) RNA binding protein, fox-1 homolog (C. elegans) 1
Rat(302920) RNA binding protein, fox-1 homolog (C. elegans) 1
Zebrafish(449554) RNA binding protein, fox-1 homolog (C. elegans) 1
Horse(100066233) RNA binding protein, fox-1 homolog (C. elegans) 1
domestic cat(101089565) RNA binding protein, fox-1 homolog (C. elegans) 1
dog(609116) RNA binding protein, fox-1 homolog (C. elegans) 1
chicken(416645) RNA binding protein, fox-1 homolog (C. elegans) 1
domestic guinea pig(100723769) RNA binding protein, fox-1 homolog (C. elegans) 1
naked mole-rat(101707083) RNA binding protein, fox-1 homolog (C. elegans) 1
cow(521304) RNA binding protein, fox-1 homolog (C. elegans) 1
sheep(101105300) RNA binding protein, fox-1 homolog (C. elegans) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145891 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073021 MISSION® esiRNA esiRNA human A2BP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018723 Rosetta Predictions human pricing
NM_145891 Rosetta Predictions human pricing
NM_145892 Rosetta Predictions human pricing
NM_145893 Rosetta Predictions human pricing
NM_001106974 Rosetta Predictions rat pricing
NM_021477 Rosetta Predictions mouse pricing
NM_183188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236281 predicted 1328
2 SASI_Hs01_00236282 predicted 1388
3 SASI_Hs01_00236283 predicted 1580
4 SASI_Hs01_00236284 predicted 1392
5 SASI_Hs01_00236285 predicted 1377
6 SASI_Hs01_00236286 predicted 1243
7 SASI_Hs01_00236287 predicted 1482
8 SASI_Hs01_00236288 predicted 1329
9 SASI_Hs01_00236290 predicted 1541
10 SASI_Hs02_00352266 predicted 1376
11 SASI_Hs01_00236289 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215007 predicted 660
2 SASI_Hs01_00215008 predicted 710
3 SASI_Hs01_00215009 predicted 913
4 SASI_Hs01_00215010 predicted 718
5 SASI_Hs01_00215011 predicted 706
6 SASI_Hs01_00215012 predicted 575
7 SASI_Hs01_00215013 predicted 808
8 SASI_Hs01_00215014 predicted 657
9 SASI_Hs01_00215016 predicted 873
10 SASI_Hs02_00365404 predicted 695
11 SASI_Hs01_00215015 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111588 predicted 659
2 SASI_Hs01_00111589 predicted 715
3 SASI_Hs01_00111590 predicted 906
4 SASI_Hs01_00111591 predicted 711
5 SASI_Hs01_00111592 predicted 706
6 SASI_Hs01_00111593 predicted 576
7 SASI_Hs01_00111594 predicted 809
8 SASI_Hs01_00111595 predicted 650
9 SASI_Hs01_00111597 predicted 864
10 SASI_Hs02_00365405 predicted 695
11 SASI_Hs01_00111596 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054602 predicted 662
2 SASI_Hs01_00054603 predicted 710
3 SASI_Hs01_00054604 predicted 912
4 SASI_Hs01_00054605 predicted 720
5 SASI_Hs01_00054606 predicted 706
6 SASI_Hs01_00054607 predicted 579
7 SASI_Hs01_00054608 predicted 810
8 SASI_Hs01_00054609 predicted 655
9 SASI_Hs01_00054611 predicted 872
10 SASI_Hs02_00365406 predicted 698
11 SASI_Hs01_00054610 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224246 predicted 670
2 SASI_Rn02_00224247 predicted 986
3 SASI_Rn02_00224248 predicted 678
4 SASI_Rn02_00224249 predicted 899
5 SASI_Rn02_00224250 predicted 1200
6 SASI_Rn02_00224251 predicted 1033
7 SASI_Rn02_00224252 predicted 232
8 SASI_Rn02_00224253 predicted 1158
9 SASI_Rn02_00224254 predicted 745
10 SASI_Rn02_00224255 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150775 predicted 1382
2 SASI_Mm01_00150776 predicted 1688
3 SASI_Mm01_00150777 predicted 1599
4 SASI_Mm01_00150778 predicted 1376
5 SASI_Mm01_00150779 predicted 1445
6 SASI_Mm01_00150780 predicted 1865
7 SASI_Mm01_00150781 predicted 1456
8 SASI_Mm01_00150782 predicted 1908
9 SASI_Mm01_00150783 predicted 1744
10 SASI_Mm01_00150784 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133743 predicted 611
2 SASI_Mm01_00133744 predicted 926
3 SASI_Mm01_00133745 predicted 1127
4 SASI_Mm02_00350299 predicted 721
5 SASI_Mm01_00133746 predicted 829
6 SASI_Mm01_00133747 predicted 1152
7 SASI_Mm01_00133748 predicted 603
8 SASI_Mm01_00133749 predicted 1102
9 SASI_Mm01_00133750 predicted 685
10 SASI_Mm01_00133751 predicted 971
11 SASI_Mm01_00133752 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021477
VALIDATED
RBFOX1 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein, fox-1 homolog (C. elegans) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1295s1c1
Sequence:CCGGCCCAGACACAACCTTCTGAAACTCGAGTTTCAGAAGGTTGTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021477.3-2764s1c1
Sequence:CCGGGCACCAACTATCATAAATCTACTCGAGTAGATTTATGATAGTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1347s1c1
Sequence:CCGGGCATGTGTCCAACATCCCTTTCTCGAGAAAGGGATGTTGGACACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1907s1c1
Sequence:CCGGGTGCAGACATTTATGGTGGTTCTCGAGAACCACCATAAATGTCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-1902s21c1
Sequence:CCGGAGCACGCGTGATGACAAATAACTCGAGTTATTTGTCATCACGCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021477.3-1389s1c1
Sequence:CCGGCCGACAAATGTTTGGTCAATTCTCGAGAATTGACCAAACATTTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-1713s21c1
Sequence:CCGGGGATCCAGACCTCCGACAAATCTCGAGATTTGTCGGAGGTCTGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-2466s21c1
Sequence:CCGGTTCATTGCAGGCTAGTATATACTCGAGTATATACTAGCCTGCAATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-2317s21c1
Sequence:CCGGGACAGTTACGGACGAGTTTATCTCGAGATAAACTCGTCCGTAACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021477.5-2859s21c1
Sequence:CCGGCCATATCCAGAGTGCTATATTCTCGAGAATATAGCACTCTGGATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021477
VALIDATED
RBFOX1 MISSION shRNA shRNA Plasmid DNA
RNA binding protein, fox-1 homolog (C. elegans) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1295s1c1
Sequence:CCGGCCCAGACACAACCTTCTGAAACTCGAGTTTCAGAAGGTTGTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021477.3-2764s1c1
Sequence:CCGGGCACCAACTATCATAAATCTACTCGAGTAGATTTATGATAGTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1347s1c1
Sequence:CCGGGCATGTGTCCAACATCCCTTTCTCGAGAAAGGGATGTTGGACACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1907s1c1
Sequence:CCGGGTGCAGACATTTATGGTGGTTCTCGAGAACCACCATAAATGTCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-1902s21c1
Sequence:CCGGAGCACGCGTGATGACAAATAACTCGAGTTATTTGTCATCACGCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021477.3-1389s1c1
Sequence:CCGGCCGACAAATGTTTGGTCAATTCTCGAGAATTGACCAAACATTTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-1713s21c1
Sequence:CCGGGGATCCAGACCTCCGACAAATCTCGAGATTTGTCGGAGGTCTGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-2466s21c1
Sequence:CCGGTTCATTGCAGGCTAGTATATACTCGAGTATATACTAGCCTGCAATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-2317s21c1
Sequence:CCGGGACAGTTACGGACGAGTTTATCTCGAGATAAACTCGTCCGTAACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021477.5-2859s21c1
Sequence:CCGGCCATATCCAGAGTGCTATATTCTCGAGAATATAGCACTCTGGATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021477
VALIDATED
RBFOX1 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein, fox-1 homolog (C. elegans) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1295s1c1
Sequence:CCGGCCCAGACACAACCTTCTGAAACTCGAGTTTCAGAAGGTTGTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021477.3-2764s1c1
Sequence:CCGGGCACCAACTATCATAAATCTACTCGAGTAGATTTATGATAGTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1347s1c1
Sequence:CCGGGCATGTGTCCAACATCCCTTTCTCGAGAAAGGGATGTTGGACACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021477.3-1907s1c1
Sequence:CCGGGTGCAGACATTTATGGTGGTTCTCGAGAACCACCATAAATGTCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-1902s21c1
Sequence:CCGGAGCACGCGTGATGACAAATAACTCGAGTTATTTGTCATCACGCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021477.3-1389s1c1
Sequence:CCGGCCGACAAATGTTTGGTCAATTCTCGAGAATTGACCAAACATTTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-1713s21c1
Sequence:CCGGGGATCCAGACCTCCGACAAATCTCGAGATTTGTCGGAGGTCTGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-2466s21c1
Sequence:CCGGTTCATTGCAGGCTAGTATATACTCGAGTATATACTAGCCTGCAATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021477.5-2317s21c1
Sequence:CCGGGACAGTTACGGACGAGTTTATCTCGAGATAAACTCGTCCGTAACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021477.5-2859s21c1
Sequence:CCGGCCATATCCAGAGTGCTATATTCTCGAGAATATAGCACTCTGGATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145891
RBFOX1 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein, fox-1 homolog (C. elegans) 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145891.1-2178s1c1
Sequence:CCGGCCGGCAGTATTCAGCTTCTTACTCGAGTAAGAAGCTGAATACTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-704s1c1
Sequence:CCGGCCGGACCTCAGACAAATGTTTCTCGAGAAACATTTGTCTGAGGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-1294s1c1
Sequence:CCGGCGCTGCCTACAGTGACAGTTACTCGAGTAACTGTCACTGTAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-922s1c1
Sequence:CCGGCCCTTATACAAATGGCTGGAACTCGAGTTCCAGCCATTTGTATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-1306s1c2
Sequence:CCGGTGACAGTTACGGACGAGTTTACTCGAGTAAACTCGTCCGTAACTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145891
RBFOX1 MISSION shRNA shRNA Plasmid DNA
RNA binding protein, fox-1 homolog (C. elegans) 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145891.1-2178s1c1
Sequence:CCGGCCGGCAGTATTCAGCTTCTTACTCGAGTAAGAAGCTGAATACTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-704s1c1
Sequence:CCGGCCGGACCTCAGACAAATGTTTCTCGAGAAACATTTGTCTGAGGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-1294s1c1
Sequence:CCGGCGCTGCCTACAGTGACAGTTACTCGAGTAACTGTCACTGTAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-922s1c1
Sequence:CCGGCCCTTATACAAATGGCTGGAACTCGAGTTCCAGCCATTTGTATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-1306s1c2
Sequence:CCGGTGACAGTTACGGACGAGTTTACTCGAGTAAACTCGTCCGTAACTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145891
RBFOX1 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein, fox-1 homolog (C. elegans) 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145891.1-2178s1c1
Sequence:CCGGCCGGCAGTATTCAGCTTCTTACTCGAGTAAGAAGCTGAATACTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-704s1c1
Sequence:CCGGCCGGACCTCAGACAAATGTTTCTCGAGAAACATTTGTCTGAGGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-1294s1c1
Sequence:CCGGCGCTGCCTACAGTGACAGTTACTCGAGTAACTGTCACTGTAGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-922s1c1
Sequence:CCGGCCCTTATACAAATGGCTGGAACTCGAGTTCCAGCCATTTGTATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145891.1-1306s1c2
Sequence:CCGGTGACAGTTACGGACGAGTTTACTCGAGTAAACTCGTCCGTAACTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)