EMAIL THIS PAGE TO A FRIEND

RBFOX2

RNA binding protein, fox-1 homolog (C. elegans) 2

201 Gene Product Result for
Synonyms: FOX2 Fox-2 HNRBP2 HRNBP2 RBM9 RTA dJ106I20.3 fxh
Gene ID:
Human(23543) Summary: This gene is one of several human genes similar to the C. elegans gene Fox-1. This gene encodes an RNA binding protein that is thought to be a key regulator of alternative exon splicing in the nervous system and other cell types. The protein binds to a conserved UGCAUG element found downstream of many alternatively spliced exons and promotes inclusion of the alternative exon in mature transcripts. The protein also interacts with the estrogen receptor 1 transcription factor and regulates estrogen receptor 1 transcriptional activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(93686) RNA binding protein, fox-1 homolog (C. elegans) 2
Rat(362950) RNA binding protein, fox-1 homolog (C. elegans) 2
Zebrafish(406569) RNA binding protein, fox-1 homolog (C. elegans) 2
chicken(418055) RNA binding protein, fox-1 homolog (C. elegans) 2
domestic cat(101091124) RNA binding protein, fox-1 homolog (C. elegans) 2
dog(481281) RNA binding protein, fox-1 homolog (C. elegans) 2
cow(514951) RNA binding protein, fox-1 homolog (C. elegans) 2
sheep(101121163) RNA binding protein, fox-1 homolog (C. elegans) 2
naked mole-rat(101707327) RNA binding protein, fox-1 homolog (C. elegans) 2
domestic guinea pig(100725472) RNA binding protein, fox-1 homolog (C. elegans) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU169371 MISSION® esiRNA esiRNA targeting mouse Rbfox2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031695 Rosetta Predictions human pricing
NM_001082576 Rosetta Predictions human pricing
NM_001082577 Rosetta Predictions human pricing
NM_001082578 Rosetta Predictions human pricing
NM_001082579 Rosetta Predictions human pricing
NM_014309 Rosetta Predictions human pricing
NM_001079895 Rosetta Predictions rat pricing
NM_001110827 Rosetta Predictions mouse pricing
NM_001110828 Rosetta Predictions mouse pricing
NM_001110829 Rosetta Predictions mouse pricing
NM_001110830 Rosetta Predictions mouse pricing
NM_053104 Rosetta Predictions mouse pricing
NM_175387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242053 predicted 822
2 SASI_Hs01_00242056 predicted 399
3 SASI_Hs01_00242057 predicted 920
4 SASI_Hs01_00242059 predicted 988
5 SASI_Hs01_00242060 predicted 921
6 SASI_Hs02_00307707 predicted 1288
7 SASI_Hs02_00307708 predicted 1256
8 SASI_Hs02_00307709 predicted 965
9 SASI_Hs02_00307710 predicted 704
10 SASI_Hs02_00307711 predicted 773
11 SASI_Hs01_00242051 predicted 649
12 SASI_Hs01_00242052 predicted 643
13 SASI_Hs01_00242054 predicted 665
14 SASI_Hs01_00242055 predicted 656
15 SASI_Hs01_00242058 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316702 predicted 823
2 SASI_Hs02_00316703 predicted 400
3 SASI_Hs02_00316704 predicted 919
4 SASI_Hs02_00316705 predicted 991
5 SASI_Hs02_00316706 predicted 923
6 SASI_Hs02_00316707 predicted 1279
7 SASI_Hs02_00316708 predicted 1245
8 SASI_Hs02_00316709 predicted 967
9 SASI_Hs02_00316710 predicted 704
10 SASI_Hs02_00316711 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316712 predicted 821
2 SASI_Hs02_00316713 predicted 1512
3 SASI_Hs02_00316714 predicted 403
4 SASI_Hs02_00316715 predicted 921
5 SASI_Hs02_00316716 predicted 1009
6 SASI_Hs02_00316717 predicted 992
7 SASI_Hs02_00316718 predicted 922
8 SASI_Hs02_00316719 predicted 1097
9 SASI_Hs02_00316720 predicted 973
10 SASI_Hs02_00316721 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316722 predicted 782
2 SASI_Hs02_00316723 predicted 355
3 SASI_Hs02_00316724 predicted 880
4 SASI_Hs02_00316725 predicted 952
5 SASI_Hs02_00316726 predicted 883
6 SASI_Hs02_00316727 predicted 1245
7 SASI_Hs02_00316728 predicted 1218
8 SASI_Hs02_00316729 predicted 929
9 SASI_Hs02_00316730 predicted 665
10 SASI_Hs02_00316731 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316732 predicted 776
2 SASI_Hs02_00316733 predicted 360
3 SASI_Hs02_00316734 predicted 882
4 SASI_Hs02_00316735 predicted 944
5 SASI_Hs02_00316736 predicted 877
6 SASI_Hs02_00316737 predicted 1243
7 SASI_Hs02_00316738 predicted 1217
8 SASI_Hs02_00316739 predicted 927
9 SASI_Hs02_00316740 predicted 668
10 SASI_Hs02_00316741 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137434 predicted 826
2 SASI_Hs01_00137437 predicted 1505
3 SASI_Hs01_00137438 predicted 404
4 SASI_Hs01_00137439 predicted 928
5 SASI_Hs01_00137440 predicted 1005
6 SASI_Hs02_00345397 predicted 994
7 SASI_Hs02_00345398 predicted 921
8 SASI_Hs02_00345399 predicted 910
9 SASI_Hs02_00345400 predicted 975
10 SASI_Hs02_00345401 predicted 710
11 SASI_Hs01_00137431 predicted 627
12 SASI_Hs01_00137432 predicted 625
13 SASI_Hs01_00137433 predicted 635
14 SASI_Hs01_00137435 predicted 648
15 SASI_Hs01_00137436 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208259 predicted 959
2 SASI_Rn02_00208260 predicted 937
3 SASI_Rn02_00208261 predicted 839
4 SASI_Rn02_00208262 predicted 1299
5 SASI_Rn02_00208263 predicted 1566
6 SASI_Rn02_00208264 predicted 971
7 SASI_Rn02_00208265 predicted 1084
8 SASI_Rn02_00208266 predicted 1219
9 SASI_Rn02_00208267 predicted 1553
10 SASI_Rn02_00208268 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305828 predicted 1046
2 SASI_Mm02_00305829 predicted 1023
3 SASI_Mm02_00305830 predicted 1060
4 SASI_Mm02_00305831 predicted 1170
5 SASI_Mm02_00305832 predicted 1381
6 SASI_Mm02_00305833 predicted 1640
7 SASI_Mm02_00305834 predicted 1898
8 SASI_Mm02_00305835 predicted 1307
9 SASI_Mm02_00305836 predicted 1633
10 SASI_Mm02_00305837 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305838 predicted 586
2 SASI_Mm02_00305839 predicted 563
3 SASI_Mm02_00305840 predicted 599
4 SASI_Mm02_00305841 predicted 715
5 SASI_Mm02_00305842 predicted 926
6 SASI_Mm02_00305843 predicted 1192
7 SASI_Mm02_00305844 predicted 850
8 SASI_Mm02_00305845 predicted 991
9 SASI_Mm02_00305846 predicted 1184
10 SASI_Mm02_00305847 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305848 predicted 588
2 SASI_Mm02_00305849 predicted 569
3 SASI_Mm02_00305850 predicted 604
4 SASI_Mm02_00305851 predicted 716
5 SASI_Mm02_00305852 predicted 929
6 SASI_Mm02_00305853 predicted 1188
7 SASI_Mm02_00305854 predicted 1440
8 SASI_Mm02_00305855 predicted 854
9 SASI_Mm02_00305856 predicted 862
10 SASI_Mm02_00305857 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305858 predicted 585
2 SASI_Mm02_00305859 predicted 567
3 SASI_Mm02_00305860 predicted 601
4 SASI_Mm02_00305861 predicted 711
5 SASI_Mm02_00305862 predicted 932
6 SASI_Mm02_00305863 predicted 1186
7 SASI_Mm02_00305864 predicted 1436
8 SASI_Mm02_00305865 predicted 850
9 SASI_Mm02_00305866 predicted 1176
10 SASI_Mm02_00305867 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337608 predicted 1048
2 SASI_Mm01_00187279 predicted 1022
3 SASI_Mm02_00337609 predicted 1054
4 SASI_Mm02_00337610 predicted 1171
5 SASI_Mm02_00337611 predicted 925
6 SASI_Mm02_00337612 predicted 1387
7 SASI_Mm02_00337613 predicted 1649
8 SASI_Mm02_00337614 predicted 1313
9 SASI_Mm02_00337615 predicted 1451
10 SASI_Mm02_00337616 predicted 1354
11 SASI_Mm01_00187278 predicted 877
12 SASI_Mm01_00187280 predicted 870
13 SASI_Mm01_00187281 predicted 881
14 SASI_Mm01_00187282 predicted 870
15 SASI_Mm01_00187283 predicted 824
16 SASI_Mm01_00187284 predicted 840
17 SASI_Mm01_00187285 predicted 821
18 SASI_Mm01_00187286 predicted 884
19 SASI_Mm01_00187287 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346219 predicted 1045
2 SASI_Mm01_00071009 predicted 1024
3 SASI_Mm02_00346220 predicted 1056
4 SASI_Mm02_00346221 predicted 1173
5 SASI_Mm02_00346222 predicted 922
6 SASI_Mm02_00346223 predicted 1387
7 SASI_Mm02_00346224 predicted 1598
8 SASI_Mm02_00346225 predicted 1856
9 SASI_Mm02_00346226 predicted 1310
10 SASI_Mm02_00346227 predicted 1357
11 SASI_Mm01_00071008 predicted 560
12 SASI_Mm01_00071010 predicted 543
13 SASI_Mm01_00071011 predicted 558
14 SASI_Mm01_00071012 predicted 544
15 SASI_Mm01_00071013 predicted 504
16 SASI_Mm01_00071014 predicted 517
17 SASI_Mm01_00071015 predicted 490
18 SASI_Mm01_00071016 predicted 555
19 SASI_Mm01_00071017 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014309
VALIDATED
RBFOX2 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein, fox-1 homolog (C. elegans) 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-824s21c1
Sequence:CCGGCGGGTTCGTAACTTTCGAGAACTCGAGTTCTCGAAAGTTACGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1404s21c1
Sequence:CCGGTTGGCGCTGTGGCGAGTTTATCTCGAGATAAACTCGCCACAGCGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1325s21c1
Sequence:CCGGGCCGCTTACAGTGACGGTTATCTCGAGATAACCGTCACTGTAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1811s21c1
Sequence:CCGGAGACATTAGGAGCCGATAAATCTCGAGATTTATCGGCTCCTAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-1421s1c1
Sequence:CCGGCCTCACTATGTTCTTTGAATACTCGAGTATTCAAAGAACATAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-766s1c1
Sequence:CCGGCATATGCAAATGGTTGGAAATCTCGAGATTTCCAACCATTTGCATATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-629s1c1
Sequence:CCGGCGGGTTCGTAACTTTCGAGAACTCGAGTTCTCGAAAGTTACGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014309.1-765s1c1
Sequence:CCGGCCATATGCAAATGGTTGGAAACTCGAGTTTCCAACCATTTGCATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014309.1-831s1c1
Sequence:CCGGGCATCCAGCTTTCAAGCAGATCTCGAGATCTGCTTGAAAGCTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1002s21c1
Sequence:CCGGGTATATGGTCCGGAGTTATATCTCGAGATATAACTCCGGACCATATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014309
VALIDATED
RBFOX2 MISSION shRNA shRNA Plasmid DNA
RNA binding protein, fox-1 homolog (C. elegans) 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-824s21c1
Sequence:CCGGCGGGTTCGTAACTTTCGAGAACTCGAGTTCTCGAAAGTTACGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1404s21c1
Sequence:CCGGTTGGCGCTGTGGCGAGTTTATCTCGAGATAAACTCGCCACAGCGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1325s21c1
Sequence:CCGGGCCGCTTACAGTGACGGTTATCTCGAGATAACCGTCACTGTAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1811s21c1
Sequence:CCGGAGACATTAGGAGCCGATAAATCTCGAGATTTATCGGCTCCTAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-1421s1c1
Sequence:CCGGCCTCACTATGTTCTTTGAATACTCGAGTATTCAAAGAACATAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-766s1c1
Sequence:CCGGCATATGCAAATGGTTGGAAATCTCGAGATTTCCAACCATTTGCATATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-629s1c1
Sequence:CCGGCGGGTTCGTAACTTTCGAGAACTCGAGTTCTCGAAAGTTACGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014309.1-765s1c1
Sequence:CCGGCCATATGCAAATGGTTGGAAACTCGAGTTTCCAACCATTTGCATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014309.1-831s1c1
Sequence:CCGGGCATCCAGCTTTCAAGCAGATCTCGAGATCTGCTTGAAAGCTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1002s21c1
Sequence:CCGGGTATATGGTCCGGAGTTATATCTCGAGATATAACTCCGGACCATATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014309
VALIDATED
RBFOX2 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein, fox-1 homolog (C. elegans) 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-824s21c1
Sequence:CCGGCGGGTTCGTAACTTTCGAGAACTCGAGTTCTCGAAAGTTACGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1404s21c1
Sequence:CCGGTTGGCGCTGTGGCGAGTTTATCTCGAGATAAACTCGCCACAGCGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1325s21c1
Sequence:CCGGGCCGCTTACAGTGACGGTTATCTCGAGATAACCGTCACTGTAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1811s21c1
Sequence:CCGGAGACATTAGGAGCCGATAAATCTCGAGATTTATCGGCTCCTAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-1421s1c1
Sequence:CCGGCCTCACTATGTTCTTTGAATACTCGAGTATTCAAAGAACATAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-766s1c1
Sequence:CCGGCATATGCAAATGGTTGGAAATCTCGAGATTTCCAACCATTTGCATATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014309.1-629s1c1
Sequence:CCGGCGGGTTCGTAACTTTCGAGAACTCGAGTTCTCGAAAGTTACGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014309.1-765s1c1
Sequence:CCGGCCATATGCAAATGGTTGGAAACTCGAGTTTCCAACCATTTGCATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014309.1-831s1c1
Sequence:CCGGGCATCCAGCTTTCAAGCAGATCTCGAGATCTGCTTGAAAGCTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_014309.2-1002s21c1
Sequence:CCGGGTATATGGTCCGGAGTTATATCTCGAGATATAACTCCGGACCATATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053104
RBFOX2 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein, fox-1 homolog (C. elegans) 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1335s1c1
Sequence:CCGGCCTCTAATCAGTCTCCCTTTACTCGAGTAAAGGGAGACTGATTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053104.3-2793s1c1
Sequence:CCGGGCCATTAAAGAGTGTGTAGAACTCGAGTTCTACACACTCTTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1334s1c1
Sequence:CCGGCCCTCTAATCAGTCTCCCTTTCTCGAGAAAGGGAGACTGATTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-927s1c1
Sequence:CCGGCGACTACATGTCTCTAATATTCTCGAGAATATTAGAGACATGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1224s1c1
Sequence:CCGGGCTGTGTATGGTCCTGAGTTACTCGAGTAACTCAGGACCATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053104
RBFOX2 MISSION shRNA shRNA Plasmid DNA
RNA binding protein, fox-1 homolog (C. elegans) 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1335s1c1
Sequence:CCGGCCTCTAATCAGTCTCCCTTTACTCGAGTAAAGGGAGACTGATTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053104.3-2793s1c1
Sequence:CCGGGCCATTAAAGAGTGTGTAGAACTCGAGTTCTACACACTCTTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1334s1c1
Sequence:CCGGCCCTCTAATCAGTCTCCCTTTCTCGAGAAAGGGAGACTGATTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-927s1c1
Sequence:CCGGCGACTACATGTCTCTAATATTCTCGAGAATATTAGAGACATGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1224s1c1
Sequence:CCGGGCTGTGTATGGTCCTGAGTTACTCGAGTAACTCAGGACCATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053104
RBFOX2 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein, fox-1 homolog (C. elegans) 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1335s1c1
Sequence:CCGGCCTCTAATCAGTCTCCCTTTACTCGAGTAAAGGGAGACTGATTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053104.3-2793s1c1
Sequence:CCGGGCCATTAAAGAGTGTGTAGAACTCGAGTTCTACACACTCTTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1334s1c1
Sequence:CCGGCCCTCTAATCAGTCTCCCTTTCTCGAGAAAGGGAGACTGATTAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-927s1c1
Sequence:CCGGCGACTACATGTCTCTAATATTCTCGAGAATATTAGAGACATGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053104.3-1224s1c1
Sequence:CCGGGCTGTGTATGGTCCTGAGTTACTCGAGTAACTCAGGACCATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)