EMAIL THIS PAGE TO A FRIEND

RBFOX3

RNA binding protein, fox-1 homolog (C. elegans) 3

77 Gene Product Result for
Synonyms: FOX-3 FOX3 HRNBP3 NEUN
UniProtKB ID: A6NFN3, B4DEG6
Gene ID:
Mouse(52897) RNA binding protein, fox-1 homolog (C. elegans) 3
Rat(287847) RNA binding protein, fox-1 homolog (C. elegans) 3
domestic guinea pig(100726916) RNA binding protein, fox-1 homolog (C. elegans) 3
naked mole-rat(101711607) RNA binding protein, fox-1 homolog (C. elegans) 3
cow(511773) RNA binding protein, fox-1 homolog (C. elegans) 3
sheep(101111982) RNA binding protein, fox-1 homolog (C. elegans) 3
Zebrafish(100538330) RNA binding protein, fox-1 homolog (C. elegans) 3
domestic cat(101084840) RNA binding protein, fox-1 homolog (C. elegans) 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001025448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001082575 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001082575 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001082575 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025448 Rosetta Predictions human pricing
NM_001082575 Rosetta Predictions human pricing
NM_001134498 Rosetta Predictions rat pricing
NM_001024931 Rosetta Predictions mouse pricing
NM_001039167 Rosetta Predictions mouse pricing
NM_001039168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143987 predicted 361
2 SASI_Hs01_00143988 predicted 381
3 SASI_Hs01_00143989 predicted 264
4 SASI_Hs01_00143990 predicted 86
5 SASI_Hs01_00143991 predicted 160
6 SASI_Hs01_00143992 predicted 262
7 SASI_Hs01_00143993 predicted 148
8 SASI_Hs01_00143994 predicted 154
9 SASI_Hs01_00143995 predicted 326
10 SASI_Hs01_00143996 predicted 82
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316692 predicted 1577
2 SASI_Hs02_00316693 predicted 753
3 SASI_Hs02_00316694 predicted 541
4 SASI_Hs02_00316695 predicted 540
5 SASI_Hs02_00316696 predicted 677
6 SASI_Hs02_00316697 predicted 1567
7 SASI_Hs02_00316698 predicted 1038
8 SASI_Hs02_00316699 predicted 958
9 SASI_Hs02_00316700 predicted 679
10 SASI_Hs02_00316701 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256469 predicted 1729
2 SASI_Rn02_00256470 predicted 1366
3 SASI_Rn02_00256471 predicted 807
4 SASI_Rn02_00256472 predicted 765
5 SASI_Rn02_00256473 predicted 1034
6 SASI_Rn02_00256474 predicted 709
7 SASI_Rn02_00256475 predicted 947
8 SASI_Rn02_00256476 predicted 1710
9 SASI_Rn02_00256477 predicted 1652
10 SASI_Rn02_00256478 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024196 predicted 1062
2 SASI_Mm01_00024197 predicted 1981
3 SASI_Mm01_00024198 predicted 1067
4 SASI_Mm01_00024199 predicted 1337
5 SASI_Mm01_00024200 predicted 927
6 SASI_Mm01_00024201 predicted 874
7 SASI_Mm01_00024202 predicted 1843
8 SASI_Mm01_00024203 predicted 822
9 SASI_Mm01_00024204 predicted 931
10 SASI_Mm01_00024205 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060330 predicted 1061
2 SASI_Mm01_00060331 predicted 1067
3 SASI_Mm01_00060332 predicted 1940
4 SASI_Mm02_00289918 predicted 656
5 SASI_Mm01_00060333 predicted 1479
6 SASI_Mm01_00060335 predicted 1740
7 SASI_Mm02_00289919 predicted 1773
8 SASI_Mm01_00060336 predicted 930
9 SASI_Mm01_00060337 predicted 874
10 SASI_Mm01_00060338 predicted 825
11 SASI_Mm01_00060334 predicted 2211
12 SASI_Mm01_00060339 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097035 predicted 1065
2 SASI_Mm01_00097036 predicted 1057
3 SASI_Mm01_00097037 predicted 1795
4 SASI_Mm01_00097038 predicted 1340
5 SASI_Mm01_00097040 predicted 1596
6 SASI_Mm02_00289920 predicted 1631
7 SASI_Mm01_00097041 predicted 923
8 SASI_Mm01_00097042 predicted 872
9 SASI_Mm01_00097043 predicted 818
10 SASI_Mm01_00097044 predicted 1153
11 SASI_Mm01_00097039 predicted 2061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024931
RBFOX3 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein, fox-1 homolog (C. elegans) 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024931.1-979s1c1
Sequence:CCGGGAACAGTCTATGGGCCTGAATCTCGAGATTCAGGCCCATAGACTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024931.1-1146s1c1
Sequence:CCGGCTGGAGCAAACGCTTGTTAAACTCGAGTTTAACAAGCGTTTGCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-1280s21c1
Sequence:CCGGCGTGCTGTGTATAATACATTTCTCGAGAAATGTATTATACACAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-1199s21c1
Sequence:CCGGTTCTATGCAGTGACCAGTTTCCTCGAGGAAACTGGTCACTGCATAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-931s21c1
Sequence:CCGGGCGGCAAATGTTCGGGCAATTCTCGAGAATTGCCCGAACATTTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024931.2-2624s21c1
Sequence:CCGGGGATAGGTGGAGTAGGGTTAACTCGAGTTAACCCTACTCCACCTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024931
RBFOX3 MISSION shRNA shRNA Plasmid DNA
RNA binding protein, fox-1 homolog (C. elegans) 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024931.1-979s1c1
Sequence:CCGGGAACAGTCTATGGGCCTGAATCTCGAGATTCAGGCCCATAGACTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024931.1-1146s1c1
Sequence:CCGGCTGGAGCAAACGCTTGTTAAACTCGAGTTTAACAAGCGTTTGCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-1280s21c1
Sequence:CCGGCGTGCTGTGTATAATACATTTCTCGAGAAATGTATTATACACAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-1199s21c1
Sequence:CCGGTTCTATGCAGTGACCAGTTTCCTCGAGGAAACTGGTCACTGCATAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-931s21c1
Sequence:CCGGGCGGCAAATGTTCGGGCAATTCTCGAGAATTGCCCGAACATTTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024931.2-2624s21c1
Sequence:CCGGGGATAGGTGGAGTAGGGTTAACTCGAGTTAACCCTACTCCACCTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024931
RBFOX3 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein, fox-1 homolog (C. elegans) 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024931.1-979s1c1
Sequence:CCGGGAACAGTCTATGGGCCTGAATCTCGAGATTCAGGCCCATAGACTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024931.1-1146s1c1
Sequence:CCGGCTGGAGCAAACGCTTGTTAAACTCGAGTTTAACAAGCGTTTGCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-1280s21c1
Sequence:CCGGCGTGCTGTGTATAATACATTTCTCGAGAAATGTATTATACACAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-1199s21c1
Sequence:CCGGTTCTATGCAGTGACCAGTTTCCTCGAGGAAACTGGTCACTGCATAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024931.2-931s21c1
Sequence:CCGGGCGGCAAATGTTCGGGCAATTCTCGAGAATTGCCCGAACATTTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024931.2-2624s21c1
Sequence:CCGGGGATAGGTGGAGTAGGGTTAACTCGAGTTAACCCTACTCCACCTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025448
VALIDATED
RBFOX3 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein, fox-1 homolog (C. elegans) 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001025448.1-157s1c1
Sequence:CCGGCTTGTTCCTTGTCCGTTCCTTCTCGAGAAGGAACGGACAAGGAACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-160s1c1
Sequence:CCGGGTTCCTTGTCCGTTCCTTGAACTCGAGTTCAAGGAACGGACAAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-203s1c1
Sequence:CCGGGAGGAAATTCTGCCACCATTTCTCGAGAAATGGTGGCAGAATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-178s1c1
Sequence:CCGGGAACAACTTGAAGTCACAGCACTCGAGTGCTGTGACTTCAAGTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-175s1c1
Sequence:CCGGCTTGAACAACTTGAAGTCACACTCGAGTGTGACTTCAAGTTGTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-171s1c1
Sequence:CCGGGTTCCTTGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCAAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-170s1c1
Sequence:CCGGCGTTCCTTGAACAACTTGAAGCTCGAGCTTCAAGTTGTTCAAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025448
VALIDATED
RBFOX3 MISSION shRNA shRNA Plasmid DNA
RNA binding protein, fox-1 homolog (C. elegans) 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001025448.1-157s1c1
Sequence:CCGGCTTGTTCCTTGTCCGTTCCTTCTCGAGAAGGAACGGACAAGGAACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-160s1c1
Sequence:CCGGGTTCCTTGTCCGTTCCTTGAACTCGAGTTCAAGGAACGGACAAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-203s1c1
Sequence:CCGGGAGGAAATTCTGCCACCATTTCTCGAGAAATGGTGGCAGAATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-178s1c1
Sequence:CCGGGAACAACTTGAAGTCACAGCACTCGAGTGCTGTGACTTCAAGTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-175s1c1
Sequence:CCGGCTTGAACAACTTGAAGTCACACTCGAGTGTGACTTCAAGTTGTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-171s1c1
Sequence:CCGGGTTCCTTGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCAAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-170s1c1
Sequence:CCGGCGTTCCTTGAACAACTTGAAGCTCGAGCTTCAAGTTGTTCAAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025448
VALIDATED
RBFOX3 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein, fox-1 homolog (C. elegans) 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001025448.1-157s1c1
Sequence:CCGGCTTGTTCCTTGTCCGTTCCTTCTCGAGAAGGAACGGACAAGGAACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-160s1c1
Sequence:CCGGGTTCCTTGTCCGTTCCTTGAACTCGAGTTCAAGGAACGGACAAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-203s1c1
Sequence:CCGGGAGGAAATTCTGCCACCATTTCTCGAGAAATGGTGGCAGAATTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-178s1c1
Sequence:CCGGGAACAACTTGAAGTCACAGCACTCGAGTGCTGTGACTTCAAGTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-175s1c1
Sequence:CCGGCTTGAACAACTTGAAGTCACACTCGAGTGTGACTTCAAGTTGTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-171s1c1
Sequence:CCGGGTTCCTTGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCAAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025448.1-170s1c1
Sequence:CCGGCGTTCCTTGAACAACTTGAAGCTCGAGCTTCAAGTTGTTCAAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082575
RBFOX3 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein, fox-1 homolog (C. elegans) 3
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000427693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082575.1-547s21c1
Sequence:CCGGGCGGCAAATGTTCGGGCAATTCTCGAGAATTGCCCGAACATTTGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082575.1-959s21c1
Sequence:CCGGGTCGTGTATCAGGATGGATTTCTCGAGAAATCCATCCTGATACACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082575
RBFOX3 MISSION shRNA shRNA Plasmid DNA
RNA binding protein, fox-1 homolog (C. elegans) 3
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000427693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082575.1-547s21c1
Sequence:CCGGGCGGCAAATGTTCGGGCAATTCTCGAGAATTGCCCGAACATTTGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082575.1-959s21c1
Sequence:CCGGGTCGTGTATCAGGATGGATTTCTCGAGAAATCCATCCTGATACACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082575
RBFOX3 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein, fox-1 homolog (C. elegans) 3
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000427693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082575.1-547s21c1
Sequence:CCGGGCGGCAAATGTTCGGGCAATTCTCGAGAATTGCCCGAACATTTGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082575.1-959s21c1
Sequence:CCGGGTCGTGTATCAGGATGGATTTCTCGAGAAATCCATCCTGATACACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)