EMAIL THIS PAGE TO A FRIEND

RBKS

ribokinase

62 Gene Product Result for
Synonyms: RBSK
UniProtKB ID: Q9H477, A9UK04
Gene ID:
Human(64080) Summary: The ribokinase encoded by this gene belongs to the pfkB family of carbohydrate kinases. It phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. [provided by RefSeq, Jul 2008]
Mouse(71336) ribokinase
Rat(362706) ribokinase
cow(513276) ribokinase
sheep(101120994) ribokinase
Zebrafish(415207) ribokinase
chicken(421418) ribokinase
dog(475710) ribokinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022128 Rosetta Predictions human pricing
NM_001108703 Rosetta Predictions rat pricing
NM_153196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192448 predicted 207
2 SASI_Hs01_00192449 predicted 461
3 SASI_Hs01_00192450 predicted 302
4 SASI_Hs02_00355526 predicted 330
5 SASI_Hs01_00192451 predicted 449
6 SASI_Hs01_00192453 predicted 835
7 SASI_Hs01_00192454 predicted 319
8 SASI_Hs01_00192455 predicted 744
9 SASI_Hs01_00192456 predicted 597
10 SASI_Hs01_00192457 predicted 568
11 SASI_Hs01_00192452 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241245 predicted 270
2 SASI_Rn02_00241246 predicted 393
3 SASI_Rn02_00241247 predicted 773
4 SASI_Rn02_00241248 predicted 488
5 SASI_Rn02_00241249 predicted 473
6 SASI_Rn02_00241250 predicted 478
7 SASI_Rn02_00241251 predicted 336
8 SASI_Rn02_00241252 predicted 455
9 SASI_Rn02_00241253 predicted 596
10 SASI_Rn02_00241254 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164081 predicted 369
2 SASI_Mm01_00164082 predicted 452
3 SASI_Mm01_00164083 predicted 285
4 SASI_Mm01_00164084 predicted 575
5 SASI_Mm01_00164085 predicted 451
6 SASI_Mm01_00164086 predicted 336
7 SASI_Mm01_00164087 predicted 467
8 SASI_Mm01_00164088 predicted 251
9 SASI_Mm01_00164089 predicted 359
10 SASI_Mm02_00343115 predicted 777
11 SASI_Mm01_00164090 predicted 233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022128
VALIDATED
RBKS MISSION shRNA Bacterial Glycerol Stock
ribokinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-773s21c1
Sequence:CCGGTCCCACAGAGAAAGTCAAGGCCTCGAGGCCTTGACTTTCTCTGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-837s1c1
Sequence:CCGGGCCTTCTACCTGGCTTACTATCTCGAGATAGTAAGCCAGGTAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-377s1c1
Sequence:CCGGCATAGTGGCTGGAGCAAATTTCTCGAGAAATTTGCTCCAGCCACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-881s1c1
Sequence:CCGGGCTCAACAGATCCAATTTCATCTCGAGATGAAATTGGATCTGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-377s21c1
Sequence:CCGGCATAGTGGCTGGAGCAAATTTCTCGAGAAATTTGCTCCAGCCACTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-129s21c1
Sequence:CCGGGAAACCATCCATGGACATAAGCTCGAGCTTATGTCCATGGATGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-101s21c1
Sequence:CCGGTCTTACTTCTCGTTTGCCAAACTCGAGTTTGGCAAACGAGAAGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-881s21c1
Sequence:CCGGGCTCAACAGATCCAATTTCATCTCGAGATGAAATTGGATCTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-129s1c1
Sequence:CCGGGAAACCATCCATGGACATAAGCTCGAGCTTATGTCCATGGATGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-101s1c1
Sequence:CCGGTCTTACTTCTCGTTTGCCAAACTCGAGTTTGGCAAACGAGAAGTAAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-932s1c1
Sequence:CCGGACAGTCATCTTACCCTTACAACTCGAGTTGTAAGGGTAAGATGACTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022128.x-957s1c1
Sequence:CCGGGACCTTCCGCTTACTCTGTTTCTCGAGAAACAGAGTAAGCGGAAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-773s1c1
Sequence:CCGGTCCCACAGAGAAAGTCAAGGCCTCGAGGCCTTGACTTTCTCTGTGGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-468s1c1
Sequence:CCGGCTCGAAATAACTCCAGCAACTCTCGAGAGTTGCTGGAGTTATTTCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022128
VALIDATED
RBKS MISSION shRNA shRNA Plasmid DNA
ribokinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-773s21c1
Sequence:CCGGTCCCACAGAGAAAGTCAAGGCCTCGAGGCCTTGACTTTCTCTGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-837s1c1
Sequence:CCGGGCCTTCTACCTGGCTTACTATCTCGAGATAGTAAGCCAGGTAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-377s1c1
Sequence:CCGGCATAGTGGCTGGAGCAAATTTCTCGAGAAATTTGCTCCAGCCACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-881s1c1
Sequence:CCGGGCTCAACAGATCCAATTTCATCTCGAGATGAAATTGGATCTGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-377s21c1
Sequence:CCGGCATAGTGGCTGGAGCAAATTTCTCGAGAAATTTGCTCCAGCCACTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-129s21c1
Sequence:CCGGGAAACCATCCATGGACATAAGCTCGAGCTTATGTCCATGGATGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-101s21c1
Sequence:CCGGTCTTACTTCTCGTTTGCCAAACTCGAGTTTGGCAAACGAGAAGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-881s21c1
Sequence:CCGGGCTCAACAGATCCAATTTCATCTCGAGATGAAATTGGATCTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-129s1c1
Sequence:CCGGGAAACCATCCATGGACATAAGCTCGAGCTTATGTCCATGGATGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-101s1c1
Sequence:CCGGTCTTACTTCTCGTTTGCCAAACTCGAGTTTGGCAAACGAGAAGTAAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-932s1c1
Sequence:CCGGACAGTCATCTTACCCTTACAACTCGAGTTGTAAGGGTAAGATGACTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022128.x-957s1c1
Sequence:CCGGGACCTTCCGCTTACTCTGTTTCTCGAGAAACAGAGTAAGCGGAAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-773s1c1
Sequence:CCGGTCCCACAGAGAAAGTCAAGGCCTCGAGGCCTTGACTTTCTCTGTGGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-468s1c1
Sequence:CCGGCTCGAAATAACTCCAGCAACTCTCGAGAGTTGCTGGAGTTATTTCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022128
VALIDATED
RBKS MISSION shRNA Lentiviral Transduction Particles
ribokinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-773s21c1
Sequence:CCGGTCCCACAGAGAAAGTCAAGGCCTCGAGGCCTTGACTTTCTCTGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-837s1c1
Sequence:CCGGGCCTTCTACCTGGCTTACTATCTCGAGATAGTAAGCCAGGTAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-377s1c1
Sequence:CCGGCATAGTGGCTGGAGCAAATTTCTCGAGAAATTTGCTCCAGCCACTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-881s1c1
Sequence:CCGGGCTCAACAGATCCAATTTCATCTCGAGATGAAATTGGATCTGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-377s21c1
Sequence:CCGGCATAGTGGCTGGAGCAAATTTCTCGAGAAATTTGCTCCAGCCACTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-129s21c1
Sequence:CCGGGAAACCATCCATGGACATAAGCTCGAGCTTATGTCCATGGATGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-101s21c1
Sequence:CCGGTCTTACTTCTCGTTTGCCAAACTCGAGTTTGGCAAACGAGAAGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022128.1-881s21c1
Sequence:CCGGGCTCAACAGATCCAATTTCATCTCGAGATGAAATTGGATCTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.1-129s1c1
Sequence:CCGGGAAACCATCCATGGACATAAGCTCGAGCTTATGTCCATGGATGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-101s1c1
Sequence:CCGGTCTTACTTCTCGTTTGCCAAACTCGAGTTTGGCAAACGAGAAGTAAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-932s1c1
Sequence:CCGGACAGTCATCTTACCCTTACAACTCGAGTTGTAAGGGTAAGATGACTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022128.x-957s1c1
Sequence:CCGGGACCTTCCGCTTACTCTGTTTCTCGAGAAACAGAGTAAGCGGAAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-773s1c1
Sequence:CCGGTCCCACAGAGAAAGTCAAGGCCTCGAGGCCTTGACTTTCTCTGTGGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_022128.x-468s1c1
Sequence:CCGGCTCGAAATAACTCCAGCAACTCTCGAGAGTTGCTGGAGTTATTTCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153196
RBKS MISSION shRNA Bacterial Glycerol Stock
ribokinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-454s1c1
Sequence:CCGGGTGATGATATGCCAGCTAGAACTCGAGTTCTAGCTGGCATATCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-337s1c1
Sequence:CCGGGCCTCCATAATTGTCAATAATCTCGAGATTATTGACAATTATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-455s1c1
Sequence:CCGGTGATGATATGCCAGCTAGAAACTCGAGTTTCTAGCTGGCATATCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-350s1c1
Sequence:CCGGTCAATAATGAAGGCCAGAATACTCGAGTATTCTGGCCTTCATTATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-763s1c1
Sequence:CCGGCCAAAGCACATTCCCACTGAACTCGAGTTCAGTGGGAATGTGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153196
RBKS MISSION shRNA shRNA Plasmid DNA
ribokinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-454s1c1
Sequence:CCGGGTGATGATATGCCAGCTAGAACTCGAGTTCTAGCTGGCATATCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-337s1c1
Sequence:CCGGGCCTCCATAATTGTCAATAATCTCGAGATTATTGACAATTATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-455s1c1
Sequence:CCGGTGATGATATGCCAGCTAGAAACTCGAGTTTCTAGCTGGCATATCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-350s1c1
Sequence:CCGGTCAATAATGAAGGCCAGAATACTCGAGTATTCTGGCCTTCATTATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-763s1c1
Sequence:CCGGCCAAAGCACATTCCCACTGAACTCGAGTTCAGTGGGAATGTGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153196
RBKS MISSION shRNA Lentiviral Transduction Particles
ribokinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-454s1c1
Sequence:CCGGGTGATGATATGCCAGCTAGAACTCGAGTTCTAGCTGGCATATCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-337s1c1
Sequence:CCGGGCCTCCATAATTGTCAATAATCTCGAGATTATTGACAATTATGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-455s1c1
Sequence:CCGGTGATGATATGCCAGCTAGAAACTCGAGTTTCTAGCTGGCATATCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-350s1c1
Sequence:CCGGTCAATAATGAAGGCCAGAATACTCGAGTATTCTGGCCTTCATTATTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153196.1-763s1c1
Sequence:CCGGCCAAAGCACATTCCCACTGAACTCGAGTTCAGTGGGAATGTGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)