EMAIL THIS PAGE TO A FRIEND

RBM10

RNA binding motif protein 10

71 Gene Product Result for
Synonyms: DXS8237E GPATC9 GPATCH9 S1-1 TARPS ZRANB5
Gene ID:
Human(8241) Summary: This gene encodes a nuclear protein that belongs to a family proteins that contain an RNA-binding motif. The encoded protein associates with hnRNP proteins and may be involved in regulating alternative splicing. Defects in this gene are the cause of the X-linked recessive disorder, TARP syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2011]
Mouse(236732) RNA binding motif protein 10
Rat(64510) RNA binding motif protein 10
dog(480895) RNA binding motif protein 10
domestic cat(101093665) RNA binding motif protein 10
cow(505749) RNA binding motif protein 10
sheep(101117477) RNA binding motif protein 10
domestic guinea pig(100726073) RNA binding motif protein 10
naked mole-rat(101716395) RNA binding motif protein 10
Domestic Rabbit(100339934) RNA binding motif protein 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005676 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005676 Rosetta Predictions human pricing
NM_152856 Rosetta Predictions human pricing
NM_152861 Rosetta Predictions rat pricing
NM_145627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199544 predicted 3115
2 SASI_Hs01_00199545 predicted 2453
3 SASI_Hs01_00199546 predicted 2100
4 SASI_Hs01_00199547 predicted 2502
5 SASI_Hs02_00340065 predicted 2271
6 SASI_Hs01_00199549 predicted 2440
7 SASI_Hs01_00199550 predicted 1669
8 SASI_Hs01_00199551 predicted 1937
9 SASI_Hs01_00199552 predicted 2064
10 SASI_Hs01_00199553 predicted 2888
11 SASI_Hs01_00199548 predicted 3126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045579 predicted 2877
2 SASI_Hs01_00045580 predicted 2211
3 SASI_Hs01_00045581 predicted 1864
4 SASI_Hs01_00045582 predicted 2268
5 SASI_Hs02_00366802 predicted 2031
6 SASI_Hs01_00045584 predicted 2206
7 SASI_Hs01_00045585 predicted 1443
8 SASI_Hs01_00045586 predicted 1698
9 SASI_Hs01_00045587 predicted 1835
10 SASI_Hs01_00045588 predicted 2653
11 SASI_Hs01_00045583 predicted 2892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041065 predicted 2837
2 SASI_Rn01_00041066 predicted 2115
3 SASI_Rn01_00041068 predicted 2609
4 SASI_Rn01_00041069 predicted 2499
5 SASI_Rn01_00041070 predicted 2755
6 SASI_Rn02_00268918 predicted 2872
7 SASI_Rn01_00041071 predicted 1258
8 SASI_Rn01_00041072 predicted 500
9 SASI_Rn02_00268919 predicted 668
10 SASI_Rn01_00041073 predicted 1657
11 SASI_Rn01_00041067 predicted 1087
12 SASI_Rn01_00041074 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047580 predicted 1449
2 SASI_Mm01_00047581 predicted 803
3 SASI_Mm01_00047583 predicted 2927
4 SASI_Mm01_00047582 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145627
VALIDATED
RBM10 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-2632s1c1
Sequence:CCGGGCCTCTGTGGACTTTGAACAACTCGAGTTGTTCAAAGTCCACAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145627.1-2897s1c1
Sequence:CCGGCAGCTTTGAAAGCAGTTTCTACTCGAGTAGAAACTGCTTTCAAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-2077s1c1
Sequence:CCGGGCACGCAGTCTCAATAAGCAACTCGAGTTGCTTATTGAGACTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-158s1c1
Sequence:CCGGCTGATCGTTCACAGGATGATACTCGAGTATCATCCTGTGAACGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145627.1-2937s21c1
Sequence:CCGGGAGGGACAGAGAAGATGAACTCTCGAGAGTTCATCTTCTCTGTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-992s21c1
Sequence:CCGGACGCCAATGACACCATTATTTCTCGAGAAATAATGGTGTCATTGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-627s1c1
Sequence:CCGGCGTCGAGTTTAGTCACTTGCACTCGAGTGCAAGTGACTAAACTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-627s21c1
Sequence:CCGGCGTCGAGTTTAGTCACTTGCACTCGAGTGCAAGTGACTAAACTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-158s21c1
Sequence:CCGGCTGATCGTTCACAGGATGATACTCGAGTATCATCCTGTGAACGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145627
VALIDATED
RBM10 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-2632s1c1
Sequence:CCGGGCCTCTGTGGACTTTGAACAACTCGAGTTGTTCAAAGTCCACAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145627.1-2897s1c1
Sequence:CCGGCAGCTTTGAAAGCAGTTTCTACTCGAGTAGAAACTGCTTTCAAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-2077s1c1
Sequence:CCGGGCACGCAGTCTCAATAAGCAACTCGAGTTGCTTATTGAGACTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-158s1c1
Sequence:CCGGCTGATCGTTCACAGGATGATACTCGAGTATCATCCTGTGAACGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145627.1-2937s21c1
Sequence:CCGGGAGGGACAGAGAAGATGAACTCTCGAGAGTTCATCTTCTCTGTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-992s21c1
Sequence:CCGGACGCCAATGACACCATTATTTCTCGAGAAATAATGGTGTCATTGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-627s1c1
Sequence:CCGGCGTCGAGTTTAGTCACTTGCACTCGAGTGCAAGTGACTAAACTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-627s21c1
Sequence:CCGGCGTCGAGTTTAGTCACTTGCACTCGAGTGCAAGTGACTAAACTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-158s21c1
Sequence:CCGGCTGATCGTTCACAGGATGATACTCGAGTATCATCCTGTGAACGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145627
VALIDATED
RBM10 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-2632s1c1
Sequence:CCGGGCCTCTGTGGACTTTGAACAACTCGAGTTGTTCAAAGTCCACAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145627.1-2897s1c1
Sequence:CCGGCAGCTTTGAAAGCAGTTTCTACTCGAGTAGAAACTGCTTTCAAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-2077s1c1
Sequence:CCGGGCACGCAGTCTCAATAAGCAACTCGAGTTGCTTATTGAGACTGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-158s1c1
Sequence:CCGGCTGATCGTTCACAGGATGATACTCGAGTATCATCCTGTGAACGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145627.1-2937s21c1
Sequence:CCGGGAGGGACAGAGAAGATGAACTCTCGAGAGTTCATCTTCTCTGTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-992s21c1
Sequence:CCGGACGCCAATGACACCATTATTTCTCGAGAAATAATGGTGTCATTGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145627.1-627s1c1
Sequence:CCGGCGTCGAGTTTAGTCACTTGCACTCGAGTGCAAGTGACTAAACTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-627s21c1
Sequence:CCGGCGTCGAGTTTAGTCACTTGCACTCGAGTGCAAGTGACTAAACTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145627.1-158s21c1
Sequence:CCGGCTGATCGTTCACAGGATGATACTCGAGTATCATCCTGTGAACGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005676
VALIDATED
RBM10 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-491s21c1
Sequence:CCGGGACATGGACTACCGTTCATATCTCGAGATATGAACGGTAGTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-3183s21c1
Sequence:CCGGGAGCAACTTCTCCACATGTTGCTCGAGCAACATGTGGAGAAGTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-2355s1c1
Sequence:CCGGCCCGCAGTCTCAACAAACAAACTCGAGTTTGTTTGTTGAGACTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-2354s1c1
Sequence:CCGGGCCCGCAGTCTCAACAAACAACTCGAGTTGTTTGTTGAGACTGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-491s1c1
Sequence:CCGGGACATGGACTACCGTTCATATCTCGAGATATGAACGGTAGTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-1501s1c1
Sequence:CCGGCAAGACCATCAATGTTGAGTTCTCGAGAACTCAACATTGATGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-1525s1c1
Sequence:CCGGCAAGGGTTCTAAGAGGGACATCTCGAGATGTCCCTCTTAGAACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-2507s21c1
Sequence:CCGGAGCATGGATCTCCCGAAATTGCTCGAGCAATTTCGGGAGATCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-895s21c1
Sequence:CCGGCTTCGCCTTCGTCGAGTTTAGCTCGAGCTAAACTCGACGAAGGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-1364s21c1
Sequence:CCGGTCCAACGTGCGCGTCATAAAGCTCGAGCTTTATGACGCGCACGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005676
VALIDATED
RBM10 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-491s21c1
Sequence:CCGGGACATGGACTACCGTTCATATCTCGAGATATGAACGGTAGTCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-3183s21c1
Sequence:CCGGGAGCAACTTCTCCACATGTTGCTCGAGCAACATGTGGAGAAGTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-2355s1c1
Sequence:CCGGCCCGCAGTCTCAACAAACAAACTCGAGTTTGTTTGTTGAGACTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-2354s1c1
Sequence:CCGGGCCCGCAGTCTCAACAAACAACTCGAGTTGTTTGTTGAGACTGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-491s1c1
Sequence:CCGGGACATGGACTACCGTTCATATCTCGAGATATGAACGGTAGTCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-1501s1c1
Sequence:CCGGCAAGACCATCAATGTTGAGTTCTCGAGAACTCAACATTGATGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-1525s1c1
Sequence:CCGGCAAGGGTTCTAAGAGGGACATCTCGAGATGTCCCTCTTAGAACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-2507s21c1
Sequence:CCGGAGCATGGATCTCCCGAAATTGCTCGAGCAATTTCGGGAGATCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-895s21c1
Sequence:CCGGCTTCGCCTTCGTCGAGTTTAGCTCGAGCTAAACTCGACGAAGGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-1364s21c1
Sequence:CCGGTCCAACGTGCGCGTCATAAAGCTCGAGCTTTATGACGCGCACGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005676
VALIDATED
RBM10 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-491s21c1
Sequence:CCGGGACATGGACTACCGTTCATATCTCGAGATATGAACGGTAGTCCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-3183s21c1
Sequence:CCGGGAGCAACTTCTCCACATGTTGCTCGAGCAACATGTGGAGAAGTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-2355s1c1
Sequence:CCGGCCCGCAGTCTCAACAAACAAACTCGAGTTTGTTTGTTGAGACTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-2354s1c1
Sequence:CCGGGCCCGCAGTCTCAACAAACAACTCGAGTTGTTTGTTGAGACTGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-491s1c1
Sequence:CCGGGACATGGACTACCGTTCATATCTCGAGATATGAACGGTAGTCCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-1501s1c1
Sequence:CCGGCAAGACCATCAATGTTGAGTTCTCGAGAACTCAACATTGATGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005676.3-1525s1c1
Sequence:CCGGCAAGGGTTCTAAGAGGGACATCTCGAGATGTCCCTCTTAGAACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-2507s21c1
Sequence:CCGGAGCATGGATCTCCCGAAATTGCTCGAGCAATTTCGGGAGATCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-895s21c1
Sequence:CCGGCTTCGCCTTCGTCGAGTTTAGCTCGAGCTAAACTCGACGAAGGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005676.3-1364s21c1
Sequence:CCGGTCCAACGTGCGCGTCATAAAGCTCGAGCTTTATGACGCGCACGTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)