EMAIL THIS PAGE TO A FRIEND

RBM11

RNA binding motif protein 11

75 Gene Product Result for
UniProtKB ID: P57052, Q6YNC2, Q8NBA1, Q8NFF6
Gene ID:
Mouse(224344) RNA binding motif protein 11
Rat(288321) RNA binding motif protein 11
naked mole-rat(101712118) RNA binding motif protein 11
domestic guinea pig(100731192) RNA binding motif protein 11
cow(539474) RNA binding motif protein 11
sheep(101118401) RNA binding motif protein 11
chicken(418467) RNA binding motif protein 11
domestic cat(101092633) RNA binding motif protein 11
dog(478383) RNA binding motif protein 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144770 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144770 Rosetta Predictions human pricing
NM_001105898 Rosetta Predictions rat pricing
NM_198302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113818 predicted 904
2 SASI_Hs01_00113819 predicted 557
3 SASI_Hs01_00113821 predicted 746
4 SASI_Hs02_00364713 predicted 253
5 SASI_Hs01_00113823 predicted 879
6 SASI_Hs02_00364714 predicted 266
7 SASI_Hs02_00364715 predicted 795
8 SASI_Hs02_00364716 predicted 909
9 SASI_Hs02_00364717 predicted 372
10 SASI_Hs01_00113820 predicted 727
11 SASI_Hs01_00113822 predicted 791
12 SASI_Hs01_00113824 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213622 predicted 365
2 SASI_Rn02_00213623 predicted 934
3 SASI_Rn02_00213624 predicted 792
4 SASI_Rn02_00213625 predicted 553
5 SASI_Rn02_00213626 predicted 447
6 SASI_Rn02_00213627 predicted 777
7 SASI_Rn02_00213628 predicted 406
8 SASI_Rn02_00213629 predicted 251
9 SASI_Rn02_00213630 predicted 541
10 SASI_Rn02_00213631 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112114 predicted 311
2 SASI_Mm01_00112115 predicted 1187
3 SASI_Mm01_00112116 predicted 276
4 SASI_Mm01_00112117 predicted 354
5 SASI_Mm01_00112118 predicted 357
6 SASI_Mm01_00112119 predicted 1090
7 SASI_Mm01_00112120 predicted 1257
8 SASI_Mm01_00112121 predicted 231
9 SASI_Mm01_00112122 predicted 231
10 SASI_Mm01_00112123 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198302
RBM11 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-497s1c1
Sequence:CCGGCGCCTTACCTCAAGAGTATTTCTCGAGAAATACTCTTGAGGTAAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-691s1c1
Sequence:CCGGCTGACCTGTATCCTAGGAATACTCGAGTATTCCTAGGATACAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-206s1c1
Sequence:CCGGGCCACTAACCAAAGTGACTCTCTCGAGAGAGTCACTTTGGTTAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198302.2-1828s1c1
Sequence:CCGGGGATAATGCAAACCCATTATGCTCGAGCATAATGGGTTTGCATTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198302.1-1096s1c1
Sequence:CCGGGCAGAACTAATGGGAATAATTCTCGAGAATTATTCCCATTAGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-496s1c1
Sequence:CCGGCCGCCTTACCTCAAGAGTATTCTCGAGAATACTCTTGAGGTAAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-324s1c1
Sequence:CCGGCGTTTGTATGGGAGACCAATTCTCGAGAATTGGTCTCCCATACAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198302
RBM11 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-497s1c1
Sequence:CCGGCGCCTTACCTCAAGAGTATTTCTCGAGAAATACTCTTGAGGTAAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-691s1c1
Sequence:CCGGCTGACCTGTATCCTAGGAATACTCGAGTATTCCTAGGATACAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-206s1c1
Sequence:CCGGGCCACTAACCAAAGTGACTCTCTCGAGAGAGTCACTTTGGTTAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198302.2-1828s1c1
Sequence:CCGGGGATAATGCAAACCCATTATGCTCGAGCATAATGGGTTTGCATTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198302.1-1096s1c1
Sequence:CCGGGCAGAACTAATGGGAATAATTCTCGAGAATTATTCCCATTAGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-496s1c1
Sequence:CCGGCCGCCTTACCTCAAGAGTATTCTCGAGAATACTCTTGAGGTAAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-324s1c1
Sequence:CCGGCGTTTGTATGGGAGACCAATTCTCGAGAATTGGTCTCCCATACAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198302
RBM11 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-497s1c1
Sequence:CCGGCGCCTTACCTCAAGAGTATTTCTCGAGAAATACTCTTGAGGTAAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-691s1c1
Sequence:CCGGCTGACCTGTATCCTAGGAATACTCGAGTATTCCTAGGATACAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-206s1c1
Sequence:CCGGGCCACTAACCAAAGTGACTCTCTCGAGAGAGTCACTTTGGTTAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217717    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198302.2-1828s1c1
Sequence:CCGGGGATAATGCAAACCCATTATGCTCGAGCATAATGGGTTTGCATTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198302.1-1096s1c1
Sequence:CCGGGCAGAACTAATGGGAATAATTCTCGAGAATTATTCCCATTAGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-496s1c1
Sequence:CCGGCCGCCTTACCTCAAGAGTATTCTCGAGAATACTCTTGAGGTAAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198302.1-324s1c1
Sequence:CCGGCGTTTGTATGGGAGACCAATTCTCGAGAATTGGTCTCCCATACAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144770
RBM11 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-891s1c1
Sequence:CCGGCCTACAAATGAAACTTACCTACTCGAGTAGGTAAGTTTCATTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1399s1c1
Sequence:CCGGGCCATATTCTTCTTCAGGTTTCTCGAGAAACCTGAAGAAGAATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-852s1c1
Sequence:CCGGGTTCCGAAAGTCTAAGAAGAACTCGAGTTCTTCTTAGACTTTCGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1608s1c1
Sequence:CCGGGCAAGGTTTGAGATGCTATATCTCGAGATATAGCATCTCAAACCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-755s1c1
Sequence:CCGGCTGACCTTTATCAGATGAATACTCGAGTATTCATCTGATAAAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-830s1c1
Sequence:CCGGGAGGCAACGAATGTAGCCAAACTCGAGTTTGGCTACATTCGTTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-589s1c1
Sequence:CCGGCCCAGCTCATATAAATGGACTCTCGAGAGTCCATTTATATGAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-745s1c1
Sequence:CCGGCCAAGTGACTCTGACCTTTATCTCGAGATAAAGGTCAGAGTCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1304s1c1
Sequence:CCGGGCAGATATTTAAGGATTGCATCTCGAGATGCAATCCTTAAATATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-856s1c1
Sequence:CCGGCGAAAGTCTAAGAAGAAGAAACTCGAGTTTCTTCTTCTTAGACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144770
RBM11 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-891s1c1
Sequence:CCGGCCTACAAATGAAACTTACCTACTCGAGTAGGTAAGTTTCATTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1399s1c1
Sequence:CCGGGCCATATTCTTCTTCAGGTTTCTCGAGAAACCTGAAGAAGAATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-852s1c1
Sequence:CCGGGTTCCGAAAGTCTAAGAAGAACTCGAGTTCTTCTTAGACTTTCGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1608s1c1
Sequence:CCGGGCAAGGTTTGAGATGCTATATCTCGAGATATAGCATCTCAAACCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-755s1c1
Sequence:CCGGCTGACCTTTATCAGATGAATACTCGAGTATTCATCTGATAAAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-830s1c1
Sequence:CCGGGAGGCAACGAATGTAGCCAAACTCGAGTTTGGCTACATTCGTTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-589s1c1
Sequence:CCGGCCCAGCTCATATAAATGGACTCTCGAGAGTCCATTTATATGAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-745s1c1
Sequence:CCGGCCAAGTGACTCTGACCTTTATCTCGAGATAAAGGTCAGAGTCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1304s1c1
Sequence:CCGGGCAGATATTTAAGGATTGCATCTCGAGATGCAATCCTTAAATATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-856s1c1
Sequence:CCGGCGAAAGTCTAAGAAGAAGAAACTCGAGTTTCTTCTTCTTAGACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144770
RBM11 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-891s1c1
Sequence:CCGGCCTACAAATGAAACTTACCTACTCGAGTAGGTAAGTTTCATTTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1399s1c1
Sequence:CCGGGCCATATTCTTCTTCAGGTTTCTCGAGAAACCTGAAGAAGAATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-852s1c1
Sequence:CCGGGTTCCGAAAGTCTAAGAAGAACTCGAGTTCTTCTTAGACTTTCGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1608s1c1
Sequence:CCGGGCAAGGTTTGAGATGCTATATCTCGAGATATAGCATCTCAAACCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-755s1c1
Sequence:CCGGCTGACCTTTATCAGATGAATACTCGAGTATTCATCTGATAAAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-830s1c1
Sequence:CCGGGAGGCAACGAATGTAGCCAAACTCGAGTTTGGCTACATTCGTTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-589s1c1
Sequence:CCGGCCCAGCTCATATAAATGGACTCTCGAGAGTCCATTTATATGAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-745s1c1
Sequence:CCGGCCAAGTGACTCTGACCTTTATCTCGAGATAAAGGTCAGAGTCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144770.2-1304s1c1
Sequence:CCGGGCAGATATTTAAGGATTGCATCTCGAGATGCAATCCTTAAATATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144770.2-856s1c1
Sequence:CCGGCGAAAGTCTAAGAAGAAGAAACTCGAGTTTCTTCTTCTTAGACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)