EMAIL THIS PAGE TO A FRIEND

RBM12

RNA binding motif protein 12

255 Gene Product Result for
Synonyms: HRIHFB2091 SWAN
UniProtKB ID: Q9NTZ6, B3KRU2, E1P5R6, O94865, Q8N3B1, Q9H196
Gene ID:
Human(10137) Summary: This gene encodes a protein that contains several RNA-binding motifs, potential transmembrane domains, and proline-rich regions. This gene and the gene for copine I overlap at map location 20q11.21. Alternative splicing in the 5' UTR results in four transcript variants. All variants encode the same protein. [provided by RefSeq, Nov 2010]
Mouse(75710) RNA binding motif protein 12
Rat(652928) RNA binding motif protein 12
Zebrafish(445379) RNA binding motif protein 12
Horse(100069590) RNA binding motif protein 12
dog(100329143) RNA binding motif protein 12
chicken(404531) RNA binding motif protein 12
cow(100138139) RNA binding motif protein 12
sheep(101117438) RNA binding motif protein 12
Domestic Rabbit(100328708) RNA binding motif protein 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006047 Rosetta Predictions human pricing
NM_152838 Rosetta Predictions human pricing
NM_001037657 Rosetta Predictions rat pricing
NM_029397 Rosetta Predictions mouse pricing
NM_170598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107400 predicted 620
2 SASI_Hs01_00107401 predicted 3040
3 SASI_Hs01_00107402 predicted 1052
4 SASI_Hs02_00340799 predicted 2971
5 SASI_Hs01_00107403 predicted 598
6 SASI_Hs02_00340800 predicted 1387
7 SASI_Hs01_00107404 predicted 1622
8 SASI_Hs01_00107405 predicted 1771
9 SASI_Hs02_00340801 predicted 3095
10 SASI_Hs01_00107406 predicted 3082
11 SASI_Hs01_00107407 predicted 1698
12 SASI_Hs01_00107408 predicted 2058
13 SASI_Hs01_00107409 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054512 predicted 587
2 SASI_Hs01_00054513 predicted 3009
3 SASI_Hs01_00054514 predicted 1013
4 SASI_Hs02_00366773 predicted 2939
5 SASI_Hs01_00054515 predicted 558
6 SASI_Hs02_00366774 predicted 1356
7 SASI_Hs01_00054516 predicted 1581
8 SASI_Hs01_00054517 predicted 1734
9 SASI_Hs02_00366775 predicted 3072
10 SASI_Hs01_00054518 predicted 3050
11 SASI_Hs01_00054519 predicted 1665
12 SASI_Hs01_00054520 predicted 2020
13 SASI_Hs01_00054521 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077765 predicted 2009
2 SASI_Rn01_00077766 predicted 3148
3 SASI_Rn01_00077768 predicted 1098
4 SASI_Rn02_00204539 predicted 2003
5 SASI_Rn01_00077769 predicted 1218
6 SASI_Rn01_00077771 predicted 3074
7 SASI_Rn01_00077772 predicted 2778
8 SASI_Rn01_00077773 predicted 2902
9 SASI_Rn02_00204540 predicted 2957
10 SASI_Rn01_00077774 predicted 3399
11 SASI_Rn01_00077767 predicted 1833
12 SASI_Rn01_00077770 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174459 predicted 2367
2 SASI_Mm01_00174460 predicted 1754
3 SASI_Mm01_00174461 predicted 1714
4 SASI_Mm02_00335293 predicted 3024
5 SASI_Mm01_00174463 predicted 2512
6 SASI_Mm01_00174464 predicted 2724
7 SASI_Mm01_00174465 predicted 2845
8 SASI_Mm02_00335294 predicted 1042
9 SASI_Mm01_00174467 predicted 466
10 SASI_Mm01_00174462 predicted 3101
11 SASI_Mm01_00174466 predicted 2528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096605 predicted 2335
2 SASI_Mm01_00096606 predicted 1723
3 SASI_Mm01_00096607 predicted 1680
4 SASI_Mm02_00343558 predicted 2988
5 SASI_Mm01_00096609 predicted 2481
6 SASI_Mm01_00096610 predicted 2693
7 SASI_Mm01_00096611 predicted 2816
8 SASI_Mm02_00343559 predicted 1003
9 SASI_Mm01_00096613 predicted 426
10 SASI_Mm01_00096608 predicted 3068
11 SASI_Mm01_00096612 predicted 2489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006047
VALIDATED
RBM12 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006047.4-4025s1c1
Sequence:CCGGGCCCATTCATAAGAAAGTGTTCTCGAGAACACTTTCTTATGAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-2422s1c1
Sequence:CCGGCCATTTAACTTTCCTGGTAATCTCGAGATTACCAGGAAAGTTAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-1255s1c1
Sequence:CCGGGCAGTGCATTTGTTGAAAGATCTCGAGATCTTTCAACAAATGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-1046s1c1
Sequence:CCGGGCTCTGGAGCACCTATGAATTCTCGAGAATTCATAGGTGCTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-446s1c1
Sequence:CCGGGTGGTACAATTAAAGGGTCAACTCGAGTTGACCCTTTAATTGTACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-436s21c1
Sequence:CCGGATGCGCACAGGTGGTACAATTCTCGAGAATTGTACCACCTGTGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-1561s21c1
Sequence:GTACCGGTACTTGAAAGGGCTACCATTTCTCGAGAAATGGTAGCCCTTTCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006047.4-4136s21c1
Sequence:CCGGTACGTGTTAGTCCTGTTATTTCTCGAGAAATAACAGGACTAACACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-1273s21c1
Sequence:CCGGGATCATGTAGGTCGAAATAATCTCGAGATTATTTCGACCTACATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-480s21c1
Sequence:CCGGGTTGAGTAGTAAGACGGAAATCTCGAGATTTCCGTCTTACTACTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006047
VALIDATED
RBM12 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006047.4-4025s1c1
Sequence:CCGGGCCCATTCATAAGAAAGTGTTCTCGAGAACACTTTCTTATGAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-2422s1c1
Sequence:CCGGCCATTTAACTTTCCTGGTAATCTCGAGATTACCAGGAAAGTTAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-1255s1c1
Sequence:CCGGGCAGTGCATTTGTTGAAAGATCTCGAGATCTTTCAACAAATGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-1046s1c1
Sequence:CCGGGCTCTGGAGCACCTATGAATTCTCGAGAATTCATAGGTGCTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-446s1c1
Sequence:CCGGGTGGTACAATTAAAGGGTCAACTCGAGTTGACCCTTTAATTGTACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-436s21c1
Sequence:CCGGATGCGCACAGGTGGTACAATTCTCGAGAATTGTACCACCTGTGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-1561s21c1
Sequence:GTACCGGTACTTGAAAGGGCTACCATTTCTCGAGAAATGGTAGCCCTTTCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006047.4-4136s21c1
Sequence:CCGGTACGTGTTAGTCCTGTTATTTCTCGAGAAATAACAGGACTAACACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-1273s21c1
Sequence:CCGGGATCATGTAGGTCGAAATAATCTCGAGATTATTTCGACCTACATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-480s21c1
Sequence:CCGGGTTGAGTAGTAAGACGGAAATCTCGAGATTTCCGTCTTACTACTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006047
VALIDATED
RBM12 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006047.4-4025s1c1
Sequence:CCGGGCCCATTCATAAGAAAGTGTTCTCGAGAACACTTTCTTATGAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-2422s1c1
Sequence:CCGGCCATTTAACTTTCCTGGTAATCTCGAGATTACCAGGAAAGTTAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-1255s1c1
Sequence:CCGGGCAGTGCATTTGTTGAAAGATCTCGAGATCTTTCAACAAATGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-1046s1c1
Sequence:CCGGGCTCTGGAGCACCTATGAATTCTCGAGAATTCATAGGTGCTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006047.4-446s1c1
Sequence:CCGGGTGGTACAATTAAAGGGTCAACTCGAGTTGACCCTTTAATTGTACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-436s21c1
Sequence:CCGGATGCGCACAGGTGGTACAATTCTCGAGAATTGTACCACCTGTGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-1561s21c1
Sequence:GTACCGGTACTTGAAAGGGCTACCATTTCTCGAGAAATGGTAGCCCTTTCAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006047.4-4136s21c1
Sequence:CCGGTACGTGTTAGTCCTGTTATTTCTCGAGAAATAACAGGACTAACACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-1273s21c1
Sequence:CCGGGATCATGTAGGTCGAAATAATCTCGAGATTATTTCGACCTACATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_006047.4-480s21c1
Sequence:CCGGGTTGAGTAGTAAGACGGAAATCTCGAGATTTCCGTCTTACTACTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029397
VALIDATED
RBM12 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 12
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-1065s1c1
Sequence:CCGGCCTGTGTTTCTGGGTCCATTACTCGAGTAATGGACCCAGAAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029397.2-538s1c1
Sequence:CCGGCGCCAGCAAATGCTAGTAGATCTCGAGATCTACTAGCATTTGCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029397.2-1882s1c1
Sequence:CCGGCCCATATAACAAACATTCCATCTCGAGATGGAATGTTTGTTATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-602s1c1
Sequence:CCGGGCCAGCAATAGTACCCAACTTCTCGAGAAGTTGGGTACTATTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-3332s1c1
Sequence:CCGGCCAGGTTAGAACCTGTGGATTCTCGAGAATCCACAGGTTCTAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1103s21c1
Sequence:CCGGCCTGTGTTTCTGGGTCCATTACTCGAGTAATGGACCCAGAAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1292s21c1
Sequence:CCGGGATCATGTAGGTCGAAATAATCTCGAGATTATTTCGACCTACATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-3340s21c1
Sequence:CCGGCCAGGTTAGAACCTGTGGATTCTCGAGAATCCACAGGTTCTAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-457s21c1
Sequence:CCGGGCGCACAGGTGGTACTATTAACTCGAGTTAATAGTACCACCTGTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1763s21c1
Sequence:CCGGTACATGGGCAATCGCTTTATTCTCGAGAATAAAGCGATTGCCCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029397
VALIDATED
RBM12 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 12
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-1065s1c1
Sequence:CCGGCCTGTGTTTCTGGGTCCATTACTCGAGTAATGGACCCAGAAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029397.2-538s1c1
Sequence:CCGGCGCCAGCAAATGCTAGTAGATCTCGAGATCTACTAGCATTTGCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029397.2-1882s1c1
Sequence:CCGGCCCATATAACAAACATTCCATCTCGAGATGGAATGTTTGTTATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-602s1c1
Sequence:CCGGGCCAGCAATAGTACCCAACTTCTCGAGAAGTTGGGTACTATTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-3332s1c1
Sequence:CCGGCCAGGTTAGAACCTGTGGATTCTCGAGAATCCACAGGTTCTAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1103s21c1
Sequence:CCGGCCTGTGTTTCTGGGTCCATTACTCGAGTAATGGACCCAGAAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1292s21c1
Sequence:CCGGGATCATGTAGGTCGAAATAATCTCGAGATTATTTCGACCTACATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-3340s21c1
Sequence:CCGGCCAGGTTAGAACCTGTGGATTCTCGAGAATCCACAGGTTCTAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-457s21c1
Sequence:CCGGGCGCACAGGTGGTACTATTAACTCGAGTTAATAGTACCACCTGTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1763s21c1
Sequence:CCGGTACATGGGCAATCGCTTTATTCTCGAGAATAAAGCGATTGCCCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029397
VALIDATED
RBM12 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 12
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-1065s1c1
Sequence:CCGGCCTGTGTTTCTGGGTCCATTACTCGAGTAATGGACCCAGAAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029397.2-538s1c1
Sequence:CCGGCGCCAGCAAATGCTAGTAGATCTCGAGATCTACTAGCATTTGCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029397.2-1882s1c1
Sequence:CCGGCCCATATAACAAACATTCCATCTCGAGATGGAATGTTTGTTATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-602s1c1
Sequence:CCGGGCCAGCAATAGTACCCAACTTCTCGAGAAGTTGGGTACTATTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102485    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029397.2-3332s1c1
Sequence:CCGGCCAGGTTAGAACCTGTGGATTCTCGAGAATCCACAGGTTCTAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1103s21c1
Sequence:CCGGCCTGTGTTTCTGGGTCCATTACTCGAGTAATGGACCCAGAAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1292s21c1
Sequence:CCGGGATCATGTAGGTCGAAATAATCTCGAGATTATTTCGACCTACATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-3340s21c1
Sequence:CCGGCCAGGTTAGAACCTGTGGATTCTCGAGAATCCACAGGTTCTAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-457s21c1
Sequence:CCGGGCGCACAGGTGGTACTATTAACTCGAGTTAATAGTACCACCTGTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029397.3-1763s21c1
Sequence:CCGGTACATGGGCAATCGCTTTATTCTCGAGAATAAAGCGATTGCCCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)