EMAIL THIS PAGE TO A FRIEND

RBM14

RNA binding motif protein 14

231 Gene Product Result for
Synonyms: COAA PSP2 SIP SYTIP1 TMEM137
Gene ID:
Human(10432) Summary: This gene encodes a ribonucleoprotein that functions as a general nuclear coactivator, and an RNA splicing modulator. This protein contains two RNA recognition motifs (RRM) at the N-terminus, and multiple hexapeptide repeat domain at the C-terminus that interacts with thyroid hormone receptor-binding protein (TRBP), and is required for transcription activation. Alternatively spliced transcript variants encoding different isoforms (with opposing effects on transcription) have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(56275) RNA binding motif protein 14
Rat(170900) RNA binding motif protein 14
chicken(426080) RNA binding motif protein 14
dog(610639) RNA binding motif protein 14
domestic cat(101088109) RNA binding motif protein 14
cow(511512) RNA binding motif protein 14
sheep(101106475) RNA binding motif protein 14
domestic guinea pig(100717548) RNA binding motif protein 14
naked mole-rat(101715235) RNA binding motif protein 14
Domestic Rabbit(100354757) RNA binding motif protein 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006328 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006328 Rosetta Predictions human pricing
XM_001072105 Rosetta Predictions rat pricing
NM_019869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212101 predicted 1483
2 SASI_Hs01_00212102 predicted 1910
3 SASI_Hs01_00212103 predicted 410
4 SASI_Hs02_00341358 predicted 626
5 SASI_Hs01_00212104 predicted 205
6 SASI_Hs01_00212105 predicted 765
7 SASI_Hs01_00212106 predicted 414
8 SASI_Hs01_00212107 predicted 2031
9 SASI_Hs01_00212109 predicted 1918
10 SASI_Hs01_00212110 predicted 404
11 SASI_Hs01_00212108 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337825 predicted 1940
2 SASI_Rn02_00337826 predicted 1271
3 SASI_Rn02_00337827 predicted 205
4 SASI_Rn02_00337828 predicted 2058
5 SASI_Rn02_00337829 predicted 1373
6 SASI_Rn02_00337830 predicted 1956
7 SASI_Rn02_00337831 predicted 1569
8 SASI_Rn02_00337832 predicted 1344
9 SASI_Rn02_00337833 predicted 2004
10 SASI_Rn02_00337834 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098610 predicted 1938
2 SASI_Mm01_00098611 predicted 370
3 SASI_Mm01_00098612 predicted 1264
4 SASI_Mm01_00098613 predicted 204
5 SASI_Mm01_00098614 predicted 2056
6 SASI_Mm01_00098615 predicted 1954
7 SASI_Mm01_00098616 predicted 795
8 SASI_Mm01_00098618 predicted 1340
9 SASI_Mm01_00098619 predicted 1999
10 SASI_Mm02_00325170 predicted 222
11 SASI_Mm01_00098617 predicted 1581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019869
VALIDATED
RBM14 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 14
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-1930s21c1
Sequence:CCGGTATGGTTCCGACCGGCGTTTACTCGAGTAAACGCCGGTCGGAACCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019869.2-441s21c1
Sequence:CCGGCATCGAGTGTGACGTGGTAAACTCGAGTTTACCACGTCACACTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-2065s21c1
Sequence:CCGGCGCTATTCGGGCTCCTATAATCTCGAGATTATAGGAGCCCGAATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-1085s1c1
Sequence:CCGGCCTTGCTTCCTATGGTAACCACTCGAGTGGTTACCATAGGAAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019869.1-2391s1c1
Sequence:CCGGGCGCGATACTTAAGGTTGTTTCTCGAGAAACAACCTTAAGTATCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-325s1c1
Sequence:CCGGGCAATGTATCGGCTGCATGTACTCGAGTACATGCAGCCGATACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-1082s1c1
Sequence:CCGGCTCCCTTGCTTCCTATGGTAACTCGAGTTACCATAGGAAGCAAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-337s1c1
Sequence:CCGGCTGCATGTACAAGTCAGGAATCTCGAGATTCCTGACTTGTACATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019869.2-2450s21c1
Sequence:CCGGCGCGATACTTAAGGTTGTTTGCTCGAGCAAACAACCTTAAGTATCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-1095s21c1
Sequence:CCGGTGCAGCTTCTTCGCTTAATTCCTCGAGGAATTAAGCGAAGAAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019869
VALIDATED
RBM14 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 14
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-1930s21c1
Sequence:CCGGTATGGTTCCGACCGGCGTTTACTCGAGTAAACGCCGGTCGGAACCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019869.2-441s21c1
Sequence:CCGGCATCGAGTGTGACGTGGTAAACTCGAGTTTACCACGTCACACTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-2065s21c1
Sequence:CCGGCGCTATTCGGGCTCCTATAATCTCGAGATTATAGGAGCCCGAATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-1085s1c1
Sequence:CCGGCCTTGCTTCCTATGGTAACCACTCGAGTGGTTACCATAGGAAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019869.1-2391s1c1
Sequence:CCGGGCGCGATACTTAAGGTTGTTTCTCGAGAAACAACCTTAAGTATCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-325s1c1
Sequence:CCGGGCAATGTATCGGCTGCATGTACTCGAGTACATGCAGCCGATACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-1082s1c1
Sequence:CCGGCTCCCTTGCTTCCTATGGTAACTCGAGTTACCATAGGAAGCAAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-337s1c1
Sequence:CCGGCTGCATGTACAAGTCAGGAATCTCGAGATTCCTGACTTGTACATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019869.2-2450s21c1
Sequence:CCGGCGCGATACTTAAGGTTGTTTGCTCGAGCAAACAACCTTAAGTATCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-1095s21c1
Sequence:CCGGTGCAGCTTCTTCGCTTAATTCCTCGAGGAATTAAGCGAAGAAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019869
VALIDATED
RBM14 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 14
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-1930s21c1
Sequence:CCGGTATGGTTCCGACCGGCGTTTACTCGAGTAAACGCCGGTCGGAACCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019869.2-441s21c1
Sequence:CCGGCATCGAGTGTGACGTGGTAAACTCGAGTTTACCACGTCACACTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-2065s21c1
Sequence:CCGGCGCTATTCGGGCTCCTATAATCTCGAGATTATAGGAGCCCGAATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-1085s1c1
Sequence:CCGGCCTTGCTTCCTATGGTAACCACTCGAGTGGTTACCATAGGAAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019869.1-2391s1c1
Sequence:CCGGGCGCGATACTTAAGGTTGTTTCTCGAGAAACAACCTTAAGTATCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-325s1c1
Sequence:CCGGGCAATGTATCGGCTGCATGTACTCGAGTACATGCAGCCGATACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-1082s1c1
Sequence:CCGGCTCCCTTGCTTCCTATGGTAACTCGAGTTACCATAGGAAGCAAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019869.1-337s1c1
Sequence:CCGGCTGCATGTACAAGTCAGGAATCTCGAGATTCCTGACTTGTACATGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019869.2-2450s21c1
Sequence:CCGGCGCGATACTTAAGGTTGTTTGCTCGAGCAAACAACCTTAAGTATCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_019869.2-1095s21c1
Sequence:CCGGTGCAGCTTCTTCGCTTAATTCCTCGAGGAATTAAGCGAAGAAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006328
RBM14 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 14
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000072694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-317s1c1
Sequence:CCGGGCCTCTTAATACTTGGAAGATCTCGAGATCTTCCAAGTATTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006328.2-2241s1c1
Sequence:CCGGCCCAGGAGATGATCCTGTTAACTCGAGTTAACAGGATCATCTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-437s1c1
Sequence:CCGGCGCGTTTGTTCACATGGAGAACTCGAGTTCTCCATGTGAACAAACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-1522s1c1
Sequence:CCGGCCCAAGCATCAATGGGCCTTTCTCGAGAAAGGCCCATTGATGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006328
RBM14 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 14
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000072694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-317s1c1
Sequence:CCGGGCCTCTTAATACTTGGAAGATCTCGAGATCTTCCAAGTATTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006328.2-2241s1c1
Sequence:CCGGCCCAGGAGATGATCCTGTTAACTCGAGTTAACAGGATCATCTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-437s1c1
Sequence:CCGGCGCGTTTGTTCACATGGAGAACTCGAGTTCTCCATGTGAACAAACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-1522s1c1
Sequence:CCGGCCCAAGCATCAATGGGCCTTTCTCGAGAAAGGCCCATTGATGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006328
RBM14 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 14
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000072694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-317s1c1
Sequence:CCGGGCCTCTTAATACTTGGAAGATCTCGAGATCTTCCAAGTATTAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006328.2-2241s1c1
Sequence:CCGGCCCAGGAGATGATCCTGTTAACTCGAGTTAACAGGATCATCTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-437s1c1
Sequence:CCGGCGCGTTTGTTCACATGGAGAACTCGAGTTCTCCATGTGAACAAACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006328.2-1522s1c1
Sequence:CCGGCCCAAGCATCAATGGGCCTTTCTCGAGAAAGGCCCATTGATGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)