EMAIL THIS PAGE TO A FRIEND

RBM17

RNA binding motif protein 17

89 Gene Product Result for
Synonyms: SPF45
UniProtKB ID: Q96I25, Q96GY6
Gene ID:
Human(84991) Summary: This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]
Mouse(76938) RNA binding motif protein 17
Rat(291295) RNA binding motif protein 17
Zebrafish(393889) RNA binding motif protein 17
Horse(100057092) RNA binding motif protein 17
domestic cat(101099811) RNA binding motif protein 17
chicken(418248) RNA binding motif protein 17
dog(478014) RNA binding motif protein 17
naked mole-rat(101721629) RNA binding motif protein 17
domestic guinea pig(100715055) RNA binding motif protein 17
cow(512694) RNA binding motif protein 17
Goat(100861023) RNA binding motif protein 17
sheep(101113165) RNA binding motif protein 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032905 Rosetta Predictions human pricing
NM_001013058 Rosetta Predictions rat pricing
NM_152824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360525 predicted 1007
2 SASI_Hs01_00197141 predicted 1072
3 SASI_Hs01_00197142 predicted 1241
4 SASI_Hs01_00197144 predicted 1270
5 SASI_Hs02_00360526 predicted 1054
6 SASI_Hs01_00197146 predicted 1042
7 SASI_Hs02_00360527 predicted 1239
8 SASI_Hs02_00360528 predicted 1121
9 SASI_Hs01_00197148 predicted 569
10 SASI_Hs01_00197149 predicted 1257
11 SASI_Hs01_00197143 predicted 471
12 SASI_Hs01_00197145 predicted 459
13 SASI_Hs01_00197147 predicted 349
14 SASI_Hs01_00197150 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108692 predicted 1230
2 SASI_Rn01_00108693 predicted 1137
3 SASI_Rn01_00108694 predicted 1043
4 SASI_Rn01_00108695 predicted 755
5 SASI_Rn01_00108696 predicted 1017
6 SASI_Rn01_00108697 predicted 1193
7 SASI_Rn01_00108698 predicted 414
8 SASI_Rn01_00108699 predicted 1246
9 SASI_Rn01_00108700 predicted 1011
10 SASI_Rn01_00108701 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073745 predicted 999
2 SASI_Mm01_00073746 predicted 726
3 SASI_Mm01_00073747 predicted 1141
4 SASI_Mm01_00073748 predicted 1040
5 SASI_Mm01_00073749 predicted 1017
6 SASI_Mm01_00073750 predicted 974
7 SASI_Mm01_00073751 predicted 1010
8 SASI_Mm01_00073752 predicted 595
9 SASI_Mm01_00073753 predicted 1249
10 SASI_Mm01_00073754 predicted 997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152824
RBM17 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 17
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-662s1c1
Sequence:CCGGCCGACGTCTCTTGTAGAGAAACTCGAGTTTCTCTACAAGAGACGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-1002s1c1
Sequence:CCGGCATCCAAGAAGTCGGATTCAACTCGAGTTGAATCCGACTTCTTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-1148s1c1
Sequence:CCGGGTTGGGAAATGTGTGATATTTCTCGAGAAATATCACACATTTCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-728s1c1
Sequence:CCGGCCGAGATCACAGTCTTCCAAACTCGAGTTTGGAAGACTGTGATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-262s21c1
Sequence:CCGGGACCAAGCAAAGTACAGTGCTCTCGAGAGCACTGTACTTTGCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-274s21c1
Sequence:CCGGTACAGTGCTTGCTCCGGTCATCTCGAGATGACCGGAGCAAGCACTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-1336s21c1
Sequence:CCGGAGAGCAAGTTTGATTGTAACTCTCGAGAGTTACAATCAAACTTGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152824
RBM17 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 17
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-662s1c1
Sequence:CCGGCCGACGTCTCTTGTAGAGAAACTCGAGTTTCTCTACAAGAGACGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-1002s1c1
Sequence:CCGGCATCCAAGAAGTCGGATTCAACTCGAGTTGAATCCGACTTCTTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-1148s1c1
Sequence:CCGGGTTGGGAAATGTGTGATATTTCTCGAGAAATATCACACATTTCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-728s1c1
Sequence:CCGGCCGAGATCACAGTCTTCCAAACTCGAGTTTGGAAGACTGTGATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-262s21c1
Sequence:CCGGGACCAAGCAAAGTACAGTGCTCTCGAGAGCACTGTACTTTGCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-274s21c1
Sequence:CCGGTACAGTGCTTGCTCCGGTCATCTCGAGATGACCGGAGCAAGCACTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-1336s21c1
Sequence:CCGGAGAGCAAGTTTGATTGTAACTCTCGAGAGTTACAATCAAACTTGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152824
RBM17 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 17
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-662s1c1
Sequence:CCGGCCGACGTCTCTTGTAGAGAAACTCGAGTTTCTCTACAAGAGACGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-1002s1c1
Sequence:CCGGCATCCAAGAAGTCGGATTCAACTCGAGTTGAATCCGACTTCTTGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-1148s1c1
Sequence:CCGGGTTGGGAAATGTGTGATATTTCTCGAGAAATATCACACATTTCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152824.1-728s1c1
Sequence:CCGGCCGAGATCACAGTCTTCCAAACTCGAGTTTGGAAGACTGTGATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-262s21c1
Sequence:CCGGGACCAAGCAAAGTACAGTGCTCTCGAGAGCACTGTACTTTGCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-274s21c1
Sequence:CCGGTACAGTGCTTGCTCCGGTCATCTCGAGATGACCGGAGCAAGCACTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152824.1-1336s21c1
Sequence:CCGGAGAGCAAGTTTGATTGTAACTCTCGAGAGTTACAATCAAACTTGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032905
VALIDATED
RBM17 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 17
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1881s1c1
Sequence:CCGGCCGGTGATCCTTAAATGAACTCTCGAGAGTTCATTTAAGGATCACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032905.x-1056s1c1
Sequence:CCGGAGGCGTAAAGACAGACATGAACTCGAGTTCATGTCTGTCTTTACGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1695s1c1
Sequence:CCGGGATGAAGCAGTACGGATATTTCTCGAGAAATATCCGTACTGCTTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032905.x-972s1c1
Sequence:CCGGGAGAAAGTAGTGAAGCGCCAACTCGAGTTGGCGCTTCACTACTTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1118s1c1
Sequence:CCGGAGATGAAGATTATGAGCGAGACTCGAGTCTCGCTCATAATCTTCATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032905.3-352s21c1
Sequence:CCGGTCCTCAGATGACCGGCAAATTCTCGAGAATTTGCCGGTCATCTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032905.3-1949s21c1
Sequence:CCGGGGCCTATTGGATGAATCATTTCTCGAGAAATGATTCATCCAATAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-1216s21c1
Sequence:CCGGGATGAAGCAGTACGGATATTTCTCGAGAAATATCCGTACTGCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-1063s21c1
Sequence:CCGGATACTTAAGTGTCCTACTAAACTCGAGTTTAGTAGGACACTTAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-461s21c1
Sequence:CCGGACGAATATGACCCTATGTTTCCTCGAGGAAACATAGGGTCATATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032905
VALIDATED
RBM17 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 17
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1881s1c1
Sequence:CCGGCCGGTGATCCTTAAATGAACTCTCGAGAGTTCATTTAAGGATCACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032905.x-1056s1c1
Sequence:CCGGAGGCGTAAAGACAGACATGAACTCGAGTTCATGTCTGTCTTTACGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1695s1c1
Sequence:CCGGGATGAAGCAGTACGGATATTTCTCGAGAAATATCCGTACTGCTTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032905.x-972s1c1
Sequence:CCGGGAGAAAGTAGTGAAGCGCCAACTCGAGTTGGCGCTTCACTACTTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1118s1c1
Sequence:CCGGAGATGAAGATTATGAGCGAGACTCGAGTCTCGCTCATAATCTTCATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032905.3-352s21c1
Sequence:CCGGTCCTCAGATGACCGGCAAATTCTCGAGAATTTGCCGGTCATCTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032905.3-1949s21c1
Sequence:CCGGGGCCTATTGGATGAATCATTTCTCGAGAAATGATTCATCCAATAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-1216s21c1
Sequence:CCGGGATGAAGCAGTACGGATATTTCTCGAGAAATATCCGTACTGCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-1063s21c1
Sequence:CCGGATACTTAAGTGTCCTACTAAACTCGAGTTTAGTAGGACACTTAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-461s21c1
Sequence:CCGGACGAATATGACCCTATGTTTCCTCGAGGAAACATAGGGTCATATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032905
VALIDATED
RBM17 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 17
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1881s1c1
Sequence:CCGGCCGGTGATCCTTAAATGAACTCTCGAGAGTTCATTTAAGGATCACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032905.x-1056s1c1
Sequence:CCGGAGGCGTAAAGACAGACATGAACTCGAGTTCATGTCTGTCTTTACGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1695s1c1
Sequence:CCGGGATGAAGCAGTACGGATATTTCTCGAGAAATATCCGTACTGCTTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_032905.x-972s1c1
Sequence:CCGGGAGAAAGTAGTGAAGCGCCAACTCGAGTTGGCGCTTCACTACTTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032905.x-1118s1c1
Sequence:CCGGAGATGAAGATTATGAGCGAGACTCGAGTCTCGCTCATAATCTTCATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032905.3-352s21c1
Sequence:CCGGTCCTCAGATGACCGGCAAATTCTCGAGAATTTGCCGGTCATCTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032905.3-1949s21c1
Sequence:CCGGGGCCTATTGGATGAATCATTTCTCGAGAAATGATTCATCCAATAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-1216s21c1
Sequence:CCGGGATGAAGCAGTACGGATATTTCTCGAGAAATATCCGTACTGCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-1063s21c1
Sequence:CCGGATACTTAAGTGTCCTACTAAACTCGAGTTTAGTAGGACACTTAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_032905.3-461s21c1
Sequence:CCGGACGAATATGACCCTATGTTTCCTCGAGGAAACATAGGGTCATATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)