EMAIL THIS PAGE TO A FRIEND

RBM19

RNA binding motif protein 19

54 Gene Product Result for
UniProtKB ID: Q9Y4C8, Q9BPY6, Q9UFN5
Gene ID:
Human(9904) Summary: This gene encodes a nucleolar protein that contains six RNA-binding motifs. The encoded protein may be involved in regulating ribosome biogenesis. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Apr 2009]
Mouse(74111) RNA binding motif protein 19
Rat(304512) RNA binding motif protein 19
Zebrafish(387255) RNA binding motif protein 19
Horse(100056226) RNA binding motif protein 19
domestic cat(101090392) RNA binding motif protein 19
dog(486284) RNA binding motif protein 19
chicken(417029) RNA binding motif protein 19
naked mole-rat(101720381) RNA binding motif protein 19
domestic guinea pig(100718991) RNA binding motif protein 19
cow(507065) RNA binding motif protein 19
sheep(101111577) RNA binding motif protein 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016196 Rosetta Predictions human pricing
NM_001107143 Rosetta Predictions rat pricing
NM_028762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014651 predicted 251
2 SASI_Hs01_00014652 predicted 2751
3 SASI_Hs01_00014653 predicted 1110
4 SASI_Hs01_00014654 predicted 1691
5 SASI_Hs01_00014655 predicted 1390
6 SASI_Hs01_00014656 predicted 1050
7 SASI_Hs01_00014657 predicted 2558
8 SASI_Hs01_00014658 predicted 1090
9 SASI_Hs01_00014659 predicted 1137
10 SASI_Hs01_00014660 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225925 predicted 1115
2 SASI_Rn02_00225926 predicted 364
3 SASI_Rn02_00225927 predicted 1584
4 SASI_Rn02_00225928 predicted 261
5 SASI_Rn02_00225929 predicted 644
6 SASI_Rn02_00225930 predicted 764
7 SASI_Rn02_00225931 predicted 1171
8 SASI_Rn02_00225932 predicted 1202
9 SASI_Rn02_00225933 predicted 1065
10 SASI_Rn02_00225934 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032243 predicted 587
2 SASI_Mm01_00032244 predicted 1154
3 SASI_Mm01_00032245 predicted 315
4 SASI_Mm02_00334353 predicted 1851
5 SASI_Mm01_00032246 predicted 497
6 SASI_Mm02_00334354 predicted 276
7 SASI_Mm01_00032247 predicted 203
8 SASI_Mm01_00032248 predicted 1782
9 SASI_Mm01_00032250 predicted 1069
10 SASI_Mm01_00032251 predicted 3057
11 SASI_Mm01_00032249 predicted 729
12 SASI_Mm01_00032252 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016196
VALIDATED
RBM19 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016196.1-3473s1c1
Sequence:CCGGGAGAGAAATAAACGCAGTAATCTCGAGATTACTGCGTTTATTTCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-2011s21c1
Sequence:CCGGGCCTATTCCAAGTTCCATCATCTCGAGATGATGGAACTTGGAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-197s21c1
Sequence:CCGGATGGCAAGTTCCGCAAGTTTGCTCGAGCAAACTTGCGGAACTTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-2012s1c1
Sequence:CCGGGCCTATTCCAAGTTCCATCATCTCGAGATGATGGAACTTGGAATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-2266s1c1
Sequence:CCGGCCCAGGATGTACTCTGTTTATCTCGAGATAAACAGAGTACATCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-702s1c1
Sequence:CCGGCGGACATGGATTACCTGAAATCTCGAGATTTCAGGTAATCCATGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-989s1c1
Sequence:CCGGCCGTTCAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-398s21c1
Sequence:CCGGACTCTACTACTCCAGAAATTACTCGAGTAATTTCTGGAGTAGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016196.2-2521s21c1
Sequence:CCGGACTAAGCCAGCCGTGACATTGCTCGAGCAATGTCACGGCTGGCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016196.2-3444s21c1
Sequence:CCGGTAGCTAGTTCTTACTTCATAACTCGAGTTATGAAGTAAGAACTAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016196
VALIDATED
RBM19 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016196.1-3473s1c1
Sequence:CCGGGAGAGAAATAAACGCAGTAATCTCGAGATTACTGCGTTTATTTCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-2011s21c1
Sequence:CCGGGCCTATTCCAAGTTCCATCATCTCGAGATGATGGAACTTGGAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-197s21c1
Sequence:CCGGATGGCAAGTTCCGCAAGTTTGCTCGAGCAAACTTGCGGAACTTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-2012s1c1
Sequence:CCGGGCCTATTCCAAGTTCCATCATCTCGAGATGATGGAACTTGGAATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-2266s1c1
Sequence:CCGGCCCAGGATGTACTCTGTTTATCTCGAGATAAACAGAGTACATCCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-702s1c1
Sequence:CCGGCGGACATGGATTACCTGAAATCTCGAGATTTCAGGTAATCCATGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-989s1c1
Sequence:CCGGCCGTTCAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-398s21c1
Sequence:CCGGACTCTACTACTCCAGAAATTACTCGAGTAATTTCTGGAGTAGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016196.2-2521s21c1
Sequence:CCGGACTAAGCCAGCCGTGACATTGCTCGAGCAATGTCACGGCTGGCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016196.2-3444s21c1
Sequence:CCGGTAGCTAGTTCTTACTTCATAACTCGAGTTATGAAGTAAGAACTAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016196
VALIDATED
RBM19 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016196.1-3473s1c1
Sequence:CCGGGAGAGAAATAAACGCAGTAATCTCGAGATTACTGCGTTTATTTCTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-2011s21c1
Sequence:CCGGGCCTATTCCAAGTTCCATCATCTCGAGATGATGGAACTTGGAATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-197s21c1
Sequence:CCGGATGGCAAGTTCCGCAAGTTTGCTCGAGCAAACTTGCGGAACTTGCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-2012s1c1
Sequence:CCGGGCCTATTCCAAGTTCCATCATCTCGAGATGATGGAACTTGGAATAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-2266s1c1
Sequence:CCGGCCCAGGATGTACTCTGTTTATCTCGAGATAAACAGAGTACATCCTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-702s1c1
Sequence:CCGGCGGACATGGATTACCTGAAATCTCGAGATTTCAGGTAATCCATGTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_016196.1-989s1c1
Sequence:CCGGCCGTTCAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTGAACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016196.2-398s21c1
Sequence:CCGGACTCTACTACTCCAGAAATTACTCGAGTAATTTCTGGAGTAGTAGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_016196.2-2521s21c1
Sequence:CCGGACTAAGCCAGCCGTGACATTGCTCGAGCAATGTCACGGCTGGCTTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016196.2-3444s21c1
Sequence:CCGGTAGCTAGTTCTTACTTCATAACTCGAGTTATGAAGTAAGAACTAGCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028762
RBM19 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-1059s1c1
Sequence:CCGGGCCATCCGAATAGTGAGAAATCTCGAGATTTCTCACTATTCGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-1638s1c1
Sequence:CCGGACGCTGTTTATGGGACCAAATCTCGAGATTTGGTCCCATAAACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028762.1-3811s1c1
Sequence:CCGGCCAACTTTATGTGAGAGTCTTCTCGAGAAGACTCTCACATAAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-2019s1c1
Sequence:CCGGGCCTATTCTAAGTTCCACCATCTCGAGATGGTGGAACTTAGAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-722s1c1
Sequence:CCGGGCTGTCAGACATGGACTACTTCTCGAGAAGTAGTCCATGTCTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028762
RBM19 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-1059s1c1
Sequence:CCGGGCCATCCGAATAGTGAGAAATCTCGAGATTTCTCACTATTCGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-1638s1c1
Sequence:CCGGACGCTGTTTATGGGACCAAATCTCGAGATTTGGTCCCATAAACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028762.1-3811s1c1
Sequence:CCGGCCAACTTTATGTGAGAGTCTTCTCGAGAAGACTCTCACATAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-2019s1c1
Sequence:CCGGGCCTATTCTAAGTTCCACCATCTCGAGATGGTGGAACTTAGAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-722s1c1
Sequence:CCGGGCTGTCAGACATGGACTACTTCTCGAGAAGTAGTCCATGTCTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028762
RBM19 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-1059s1c1
Sequence:CCGGGCCATCCGAATAGTGAGAAATCTCGAGATTTCTCACTATTCGGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-1638s1c1
Sequence:CCGGACGCTGTTTATGGGACCAAATCTCGAGATTTGGTCCCATAAACAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028762.1-3811s1c1
Sequence:CCGGCCAACTTTATGTGAGAGTCTTCTCGAGAAGACTCTCACATAAAGTTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-2019s1c1
Sequence:CCGGGCCTATTCTAAGTTCCACCATCTCGAGATGGTGGAACTTAGAATAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028762.1-722s1c1
Sequence:CCGGGCTGTCAGACATGGACTACTTCTCGAGAAGTAGTCCATGTCTGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)