EMAIL THIS PAGE TO A FRIEND

RBM22

RNA binding motif protein 22

112 Gene Product Result for
Synonyms: Cwc2 ZC3H16 fSAP47
UniProtKB ID: Q9NW64, A6NDM5, B4DLI9, O95607
Gene ID:
Human(55696) Summary: This gene encodes an RNA binding protein. The encoded protein may play a role in cell division and may be involved in pre-mRNA splicing. Related pseudogenes exist on chromosomes 6, 7, 9, 13, 16, 18, and X. [provided by RefSeq, Mar 2009]
Mouse(66810) RNA binding motif protein 22
Rat(307410) RNA binding motif protein 22
Zebrafish(406495) RNA binding motif protein 22
chicken(416270) RNA binding motif protein 22
domestic cat(101082629) RNA binding motif protein 22
dog(489184) RNA binding motif protein 22
naked mole-rat(101697142) RNA binding motif protein 22
Domestic Rabbit(100345063) RNA binding motif protein 22
domestic guinea pig(100728739) RNA binding motif protein 22
cow(512330) RNA binding motif protein 22
sheep(101103064) RNA binding motif protein 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21287 Anti-199G4 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human
western blot pricing
AV40888 Anti-RBM22 (AB1) antibody produced in rabbit affinity isolated antibody rat, mouse, guinea pig, horse, human, dog, bovine, rabbit
western blot pricing
AV40889 Anti-RBM22 (AB2) antibody produced in rabbit affinity isolated antibody human, bovine, rat, mouse, rabbit, guinea pig, dog
immunohistochemistry, western blot pricing
HPA001634 Anti-RBM22 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018047 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018047 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018047 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018047 Rosetta Predictions human pricing
NM_001025676 Rosetta Predictions rat pricing
NM_025776 Rosetta Predictions mouse pricing
XM_619541 Rosetta Predictions mouse pricing
XM_901661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124886 predicted 1382
2 SASI_Hs01_00124887 predicted 673
3 SASI_Hs01_00124889 predicted 930
4 SASI_Hs02_00351172 predicted 818
5 SASI_Hs01_00124890 predicted 1359
6 SASI_Hs01_00124891 predicted 765
7 SASI_Hs02_00351173 predicted 404
8 SASI_Hs01_00124892 predicted 283
9 SASI_Hs01_00124893 predicted 949
10 SASI_Hs02_00351174 predicted 1216
11 SASI_Hs01_00124888 predicted 408
12 SASI_Hs01_00124894 predicted 721
13 SASI_Hs01_00124895 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050466 predicted 265
2 SASI_Rn01_00050467 predicted 795
3 SASI_Rn01_00050468 predicted 754
4 SASI_Rn01_00050469 predicted 646
5 SASI_Rn01_00050470 predicted 367
6 SASI_Rn01_00050471 predicted 731
7 SASI_Rn01_00050472 predicted 480
8 SASI_Rn01_00050473 predicted 741
9 SASI_Rn01_00050474 predicted 198
10 SASI_Rn01_00050475 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328986 predicted 1394
2 SASI_Mm02_00328987 predicted 469
3 SASI_Mm02_00328988 predicted 253
4 SASI_Mm02_00328989 predicted 641
5 SASI_Mm02_00328990 predicted 769
6 SASI_Mm02_00328991 predicted 283
7 SASI_Mm02_00328992 predicted 354
8 SASI_Mm02_00328993 predicted 252
9 SASI_Mm02_00328994 predicted 713
10 SASI_Mm02_00328995 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229438 predicted 520
2 SASI_Mm01_00229439 predicted 688
3 SASI_Mm01_00229440 predicted 1393
4 SASI_Mm01_00229441 predicted 1382
5 SASI_Mm01_00229442 predicted 831
6 SASI_Mm01_00229443 predicted 338
7 SASI_Mm01_00229444 predicted 416
8 SASI_Mm01_00229445 predicted 301
9 SASI_Mm01_00229446 predicted 765
10 SASI_Mm01_00229447 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245696 predicted 516
2 SASI_Mm01_00245697 predicted 826
3 SASI_Mm01_00245698 predicted 693
4 SASI_Mm01_00245699 predicted 910
5 SASI_Mm01_00245700 predicted 954
6 SASI_Mm01_00245701 predicted 343
7 SASI_Mm01_00245702 predicted 416
8 SASI_Mm01_00245703 predicted 300
9 SASI_Mm01_00245704 predicted 772
10 SASI_Mm01_00245705 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018047
VALIDATED
RBM22 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-1112s1c1
Sequence:CCGGCTCTGCCAACTACTTCAACTTCTCGAGAAGTTGAAGTAGTTGGCAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018047.1-222s1c1
Sequence:CCGGGCCAGGCCATTCACAGTGTTTCTCGAGAAACACTGTGAATGGCCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-802s21c1
Sequence:CCGGCCATTACTGAGACAGATTTAACTCGAGTTAAATCTGTCTCAGTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018047.1-663s21c1
Sequence:CCGGCAGAATATTAAAGACCGTTATCTCGAGATAACGGTCTTTAATATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-1826s1c1
Sequence:CCGGCCTCCGAAAGATGAGTAGAAACTCGAGTTTCTACTCATCTTTCGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-961s1c1
Sequence:CCGGGCCGCAGACTGAATGTGAAATCTCGAGATTTCACATTCAGTCTGCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018047.1-399s1c1
Sequence:CCGGCCAAAGTCAGATGTCAACAAACTCGAGTTTGTTGACATCTGACTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018047.1-1508s21c1
Sequence:CCGGGGATCGATGGACCGTAAATAACTCGAGTTATTTACGGTCCATCGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-409s21c1
Sequence:CCGGATGTCAACAAAGAGTACTATACTCGAGTATAGTACTCTTTGTTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-287s21c1
Sequence:CCGGGTGCCAAACCTGCAGTAAATTCTCGAGAATTTACTGCAGGTTTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018047
VALIDATED
RBM22 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-1112s1c1
Sequence:CCGGCTCTGCCAACTACTTCAACTTCTCGAGAAGTTGAAGTAGTTGGCAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018047.1-222s1c1
Sequence:CCGGGCCAGGCCATTCACAGTGTTTCTCGAGAAACACTGTGAATGGCCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-802s21c1
Sequence:CCGGCCATTACTGAGACAGATTTAACTCGAGTTAAATCTGTCTCAGTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018047.1-663s21c1
Sequence:CCGGCAGAATATTAAAGACCGTTATCTCGAGATAACGGTCTTTAATATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-1826s1c1
Sequence:CCGGCCTCCGAAAGATGAGTAGAAACTCGAGTTTCTACTCATCTTTCGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-961s1c1
Sequence:CCGGGCCGCAGACTGAATGTGAAATCTCGAGATTTCACATTCAGTCTGCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018047.1-399s1c1
Sequence:CCGGCCAAAGTCAGATGTCAACAAACTCGAGTTTGTTGACATCTGACTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018047.1-1508s21c1
Sequence:CCGGGGATCGATGGACCGTAAATAACTCGAGTTATTTACGGTCCATCGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-409s21c1
Sequence:CCGGATGTCAACAAAGAGTACTATACTCGAGTATAGTACTCTTTGTTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-287s21c1
Sequence:CCGGGTGCCAAACCTGCAGTAAATTCTCGAGAATTTACTGCAGGTTTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018047
VALIDATED
RBM22 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-1112s1c1
Sequence:CCGGCTCTGCCAACTACTTCAACTTCTCGAGAAGTTGAAGTAGTTGGCAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018047.1-222s1c1
Sequence:CCGGGCCAGGCCATTCACAGTGTTTCTCGAGAAACACTGTGAATGGCCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-802s21c1
Sequence:CCGGCCATTACTGAGACAGATTTAACTCGAGTTAAATCTGTCTCAGTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018047.1-663s21c1
Sequence:CCGGCAGAATATTAAAGACCGTTATCTCGAGATAACGGTCTTTAATATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-1826s1c1
Sequence:CCGGCCTCCGAAAGATGAGTAGAAACTCGAGTTTCTACTCATCTTTCGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_018047.1-961s1c1
Sequence:CCGGGCCGCAGACTGAATGTGAAATCTCGAGATTTCACATTCAGTCTGCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018047.1-399s1c1
Sequence:CCGGCCAAAGTCAGATGTCAACAAACTCGAGTTTGTTGACATCTGACTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018047.1-1508s21c1
Sequence:CCGGGGATCGATGGACCGTAAATAACTCGAGTTATTTACGGTCCATCGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-409s21c1
Sequence:CCGGATGTCAACAAAGAGTACTATACTCGAGTATAGTACTCTTTGTTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018047.1-287s21c1
Sequence:CCGGGTGCCAAACCTGCAGTAAATTCTCGAGAATTTACTGCAGGTTTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025776
VALIDATED
RBM22 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-886s21c1
Sequence:CCGGAGCCGCTGAGAAGTCCTTTAACTCGAGTTAAAGGACTTCTCAGCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-250s21c1
Sequence:CCGGGTGCCAAACCTGCAGTAAATTCTCGAGAATTTACTGCAGGTTTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-1501s21c1
Sequence:CCGGACATAGCTGCTTACCACTATACTCGAGTATAGTGGTAAGCAGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-325s21c1
Sequence:CCGGGGTTCGTGATGCAGGATTATCCTCGAGGATAATCCTGCATCACGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-360s21c1
Sequence:CCGGTGCCTAAGTCAGATGTCAATACTCGAGTATTGACATCTGACTTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025776
VALIDATED
RBM22 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-886s21c1
Sequence:CCGGAGCCGCTGAGAAGTCCTTTAACTCGAGTTAAAGGACTTCTCAGCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-250s21c1
Sequence:CCGGGTGCCAAACCTGCAGTAAATTCTCGAGAATTTACTGCAGGTTTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-1501s21c1
Sequence:CCGGACATAGCTGCTTACCACTATACTCGAGTATAGTGGTAAGCAGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-325s21c1
Sequence:CCGGGGTTCGTGATGCAGGATTATCCTCGAGGATAATCCTGCATCACGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-360s21c1
Sequence:CCGGTGCCTAAGTCAGATGTCAATACTCGAGTATTGACATCTGACTTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025776
VALIDATED
RBM22 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-886s21c1
Sequence:CCGGAGCCGCTGAGAAGTCCTTTAACTCGAGTTAAAGGACTTCTCAGCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-250s21c1
Sequence:CCGGGTGCCAAACCTGCAGTAAATTCTCGAGAATTTACTGCAGGTTTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238836    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-1501s21c1
Sequence:CCGGACATAGCTGCTTACCACTATACTCGAGTATAGTGGTAAGCAGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-325s21c1
Sequence:CCGGGGTTCGTGATGCAGGATTATCCTCGAGGATAATCCTGCATCACGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025776.2-360s21c1
Sequence:CCGGTGCCTAAGTCAGATGTCAATACTCGAGTATTGACATCTGACTTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)