EMAIL THIS PAGE TO A FRIEND

RBM23

RNA binding motif protein 23

113 Gene Product Result for
Synonyms: CAPERbeta RNPC4
Gene ID:
Human(55147) Summary: This gene encodes a member of the U2AF-like family of RNA binding proteins. This protein interacts with some steroid nuclear receptors, localizes to the promoter of a steroid- responsive gene, and increases transcription of steroid-responsive transcriptional reporters in a hormone-dependent manner. It is also implicated in the steroid receptor-dependent regulation of alternative splicing. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
dog(480241) RNA binding motif protein 23
domestic cat(101090524) RNA binding motif protein 23
Horse(100052786) RNA binding motif protein 23
cow(513711) RNA binding motif protein 23
sheep(101103725) RNA binding motif protein 23
naked mole-rat(101709707) RNA binding motif protein 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018107 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061811 MISSION® esiRNA esiRNA human RBM23 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077351 Rosetta Predictions human pricing
NM_001077352 Rosetta Predictions human pricing
NM_018107 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312384 predicted 1038
2 SASI_Hs02_00312385 predicted 1088
3 SASI_Hs02_00312386 predicted 1077
4 SASI_Hs02_00312387 predicted 1996
5 SASI_Hs02_00312388 predicted 1923
6 SASI_Hs02_00312389 predicted 1813
7 SASI_Hs02_00312390 predicted 1948
8 SASI_Hs02_00312391 predicted 1095
9 SASI_Hs02_00312392 predicted 1892
10 SASI_Hs02_00312393 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312394 predicted 940
2 SASI_Hs02_00312395 predicted 980
3 SASI_Hs02_00312396 predicted 968
4 SASI_Hs02_00312397 predicted 1897
5 SASI_Hs02_00312398 predicted 1822
6 SASI_Hs02_00312399 predicted 1712
7 SASI_Hs02_00312400 predicted 1852
8 SASI_Hs02_00312401 predicted 997
9 SASI_Hs02_00312402 predicted 1790
10 SASI_Hs02_00312403 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351296 predicted 996
2 SASI_Hs02_00351297 predicted 1034
3 SASI_Hs02_00351298 predicted 1022
4 SASI_Hs02_00351299 predicted 1947
5 SASI_Hs02_00351300 predicted 1877
6 SASI_Hs01_00052919 predicted 1765
7 SASI_Hs02_00351301 predicted 1901
8 SASI_Hs01_00052922 predicted 1051
9 SASI_Hs02_00351302 predicted 1845
10 SASI_Hs02_00351303 predicted 1061
11 SASI_Hs01_00052918 predicted 1052
12 SASI_Hs01_00052920 predicted 1719
13 SASI_Hs01_00052921 predicted 719
14 SASI_Hs01_00052923 predicted 254
15 SASI_Hs01_00052924 predicted 657
16 SASI_Hs01_00052925 predicted 740
17 SASI_Hs01_00052926 predicted 700
18 SASI_Hs01_00052927 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018107
VALIDATED
RBM23 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 23
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-1043s21c1
Sequence:CCGGTCAGATACAGGCCGCTCTAAACTCGAGTTTAGAGCGGCCTGTATCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-236s21c1
Sequence:CCGGATGCTGGAAGCTCCCTATAAACTCGAGTTTATAGGGAGCTTCCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-395s21c1
Sequence:CCGGGATCGGTATAGACGGAGAAATCTCGAGATTTCTCCGTCTATACCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-537s21c1
Sequence:CCGGCTCCACTTGCCACTGGTTATACTCGAGTATAACCAGTGGCAAGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-2299s21c1
Sequence:CCGGGCCTCAACCCTGGCAATTATACTCGAGTATAATTGCCAGGGTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-2160s1c1
Sequence:CCGGCTTTCCAGTATCTTCCATCTTCTCGAGAAGATGGAAGATACTGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018107.3-542s1c1
Sequence:CCGGGACACAGTAAGAGTCCTCATTCTCGAGAATGAGGACTCTTACTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-244s1c1
Sequence:CCGGGATGAGCAACAAAGGAAAGAACTCGAGTTCTTTCCTTTGTTGCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018107.3-937s1c1
Sequence:CCGGCTGCACTTCAATATCACTGAACTCGAGTTCAGTGATATTGAAGTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018107.3-589s1c1
Sequence:CCGGCCAGTTGATAATCTGAGTCCTCTCGAGAGGACTCAGATTATCAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-1589s1c1
Sequence:CCGGCCACCCTTAAGATACCAAGAACTCGAGTTCTTGGTATCTTAAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018107
VALIDATED
RBM23 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 23
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-1043s21c1
Sequence:CCGGTCAGATACAGGCCGCTCTAAACTCGAGTTTAGAGCGGCCTGTATCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-236s21c1
Sequence:CCGGATGCTGGAAGCTCCCTATAAACTCGAGTTTATAGGGAGCTTCCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-395s21c1
Sequence:CCGGGATCGGTATAGACGGAGAAATCTCGAGATTTCTCCGTCTATACCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-537s21c1
Sequence:CCGGCTCCACTTGCCACTGGTTATACTCGAGTATAACCAGTGGCAAGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-2299s21c1
Sequence:CCGGGCCTCAACCCTGGCAATTATACTCGAGTATAATTGCCAGGGTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-2160s1c1
Sequence:CCGGCTTTCCAGTATCTTCCATCTTCTCGAGAAGATGGAAGATACTGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018107.3-542s1c1
Sequence:CCGGGACACAGTAAGAGTCCTCATTCTCGAGAATGAGGACTCTTACTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-244s1c1
Sequence:CCGGGATGAGCAACAAAGGAAAGAACTCGAGTTCTTTCCTTTGTTGCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018107.3-937s1c1
Sequence:CCGGCTGCACTTCAATATCACTGAACTCGAGTTCAGTGATATTGAAGTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018107.3-589s1c1
Sequence:CCGGCCAGTTGATAATCTGAGTCCTCTCGAGAGGACTCAGATTATCAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-1589s1c1
Sequence:CCGGCCACCCTTAAGATACCAAGAACTCGAGTTCTTGGTATCTTAAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018107
VALIDATED
RBM23 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 23
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-1043s21c1
Sequence:CCGGTCAGATACAGGCCGCTCTAAACTCGAGTTTAGAGCGGCCTGTATCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-236s21c1
Sequence:CCGGATGCTGGAAGCTCCCTATAAACTCGAGTTTATAGGGAGCTTCCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-395s21c1
Sequence:CCGGGATCGGTATAGACGGAGAAATCTCGAGATTTCTCCGTCTATACCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-537s21c1
Sequence:CCGGCTCCACTTGCCACTGGTTATACTCGAGTATAACCAGTGGCAAGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018107.4-2299s21c1
Sequence:CCGGGCCTCAACCCTGGCAATTATACTCGAGTATAATTGCCAGGGTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-2160s1c1
Sequence:CCGGCTTTCCAGTATCTTCCATCTTCTCGAGAAGATGGAAGATACTGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018107.3-542s1c1
Sequence:CCGGGACACAGTAAGAGTCCTCATTCTCGAGAATGAGGACTCTTACTGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-244s1c1
Sequence:CCGGGATGAGCAACAAAGGAAAGAACTCGAGTTCTTTCCTTTGTTGCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018107.3-937s1c1
Sequence:CCGGCTGCACTTCAATATCACTGAACTCGAGTTCAGTGATATTGAAGTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018107.3-589s1c1
Sequence:CCGGCCAGTTGATAATCTGAGTCCTCTCGAGAGGACTCAGATTATCAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018107.3-1589s1c1
Sequence:CCGGCCACCCTTAAGATACCAAGAACTCGAGTTCTTGGTATCTTAAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)