EMAIL THIS PAGE TO A FRIEND

RBM24

RNA binding motif protein 24

231 Gene Product Result for
Synonyms: RNPC6 dJ259A10.1
UniProtKB ID: Q9BX46, E9PAY4, Q6QDA4, Q8N9D3, Q96NI3
Gene ID:
Mouse(666794) RNA binding motif protein 24
Rat(690139) RNA binding motif protein 24
naked mole-rat(101708413) RNA binding motif protein 24
domestic guinea pig(100720427) RNA binding motif protein 24
cow(524220) RNA binding motif protein 24
chicken(420846) RNA binding motif protein 24
dog(610452) RNA binding motif protein 24
domestic cat(101091786) RNA binding motif protein 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153020 Rosetta Predictions human pricing
XM_001073426 Rosetta Predictions rat pricing
NM_001081425 Rosetta Predictions mouse pricing
XM_989352 Rosetta Predictions mouse pricing
XM_989380 Rosetta Predictions mouse pricing
XM_989409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094931 predicted 1043
2 SASI_Hs01_00094932 predicted 1020
3 SASI_Hs01_00094933 predicted 1091
4 SASI_Hs01_00094934 predicted 1120
5 SASI_Hs02_00366974 predicted 1041
6 SASI_Hs01_00094935 predicted 277
7 SASI_Hs01_00094936 predicted 863
8 SASI_Hs01_00094937 predicted 287
9 SASI_Hs01_00094939 predicted 386
10 SASI_Hs01_00094940 predicted 289
11 SASI_Hs01_00094938 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342831 predicted 1254
2 SASI_Rn02_00342832 predicted 915
3 SASI_Rn02_00342833 predicted 845
4 SASI_Rn02_00342834 predicted 1015
5 SASI_Rn02_00342835 predicted 940
6 SASI_Rn02_00342836 predicted 833
7 SASI_Rn02_00342837 predicted 855
8 SASI_Rn02_00342838 predicted 1359
9 SASI_Rn02_00342839 predicted 1282
10 SASI_Rn02_00342840 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298261 predicted 891
2 SASI_Mm02_00298262 predicted 1008
3 SASI_Mm02_00298263 predicted 971
4 SASI_Mm02_00298264 predicted 1027
5 SASI_Mm02_00298265 predicted 1497
6 SASI_Mm02_00298266 predicted 1047
7 SASI_Mm02_00298267 predicted 1827
8 SASI_Mm02_00298268 predicted 732
9 SASI_Mm02_00298269 predicted 1706
10 SASI_Mm02_00298270 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989352 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265725 predicted 213
2 SASI_Mm01_00265726 predicted 481
3 SASI_Mm01_00265727 predicted 621
4 SASI_Mm01_00265728 predicted 763
5 SASI_Mm01_00265729 predicted 115
6 SASI_Mm01_00265730 predicted 507
7 SASI_Mm01_00265731 predicted 726
8 SASI_Mm01_00265732 predicted 145
9 SASI_Mm01_00265733 predicted 587
10 SASI_Mm01_00265734 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227362 predicted 343
2 SASI_Mm01_00227363 predicted 291
3 SASI_Mm01_00227364 predicted 374
4 SASI_Mm01_00227365 predicted 256
5 SASI_Mm01_00227366 predicted 446
6 SASI_Mm01_00227367 predicted 316
7 SASI_Mm01_00227368 predicted 710
8 SASI_Mm01_00227369 predicted 1132
9 SASI_Mm01_00227370 predicted 988
10 SASI_Mm01_00227371 predicted 813
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279439 predicted 1059
2 SASI_Mm01_00279440 predicted 894
3 SASI_Mm01_00279441 predicted 1011
4 SASI_Mm01_00279442 predicted 975
5 SASI_Mm01_00279443 predicted 1039
6 SASI_Mm01_00279444 predicted 739
7 SASI_Mm01_00279445 predicted 1711
8 SASI_Mm01_00279446 predicted 752
9 SASI_Mm01_00279447 predicted 1085
10 SASI_Mm01_00279448 predicted 1531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153020
VALIDATED
RBM24 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 24
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153020.1-1040s1c1
Sequence:CCGGGCGAGCAATATGTAGCTTGAACTCGAGTTCAAGCTACATATTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-260s1c1
Sequence:CCGGAGCCCTTATACAAAGACCTTTCTCGAGAAAGGTCTTTGTATAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-234s1c1
Sequence:CCGGGCCTTTGGTGTTCAACAACTTCTCGAGAAGTTGTTGAACACCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-395s1c1
Sequence:CCGGTGGAGCTGCATACGCACAATACTCGAGTATTGTGCGTATGCAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-286s21c1
Sequence:CCGGTACCTGCCCACTATGTCTATCCTCGAGGATAGACATAGTGGGCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-626s21c1
Sequence:CCGGGCAGACAGACCGAATGCAATACTCGAGTATTGCATTCGGTCTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-234s21c1
Sequence:CCGGGCCTTTGGTGTTCAACAACTTCTCGAGAAGTTGTTGAACACCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_153020.2-156s21c1
Sequence:CCGGCCCATCATTGATGGCAGAAAGCTCGAGCTTTCTGCCATCAATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_153020.2-1041s21c1
Sequence:CCGGGCGAGCAATATGTAGCTTGAACTCGAGTTCAAGCTACATATTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153020
VALIDATED
RBM24 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 24
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153020.1-1040s1c1
Sequence:CCGGGCGAGCAATATGTAGCTTGAACTCGAGTTCAAGCTACATATTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-260s1c1
Sequence:CCGGAGCCCTTATACAAAGACCTTTCTCGAGAAAGGTCTTTGTATAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-234s1c1
Sequence:CCGGGCCTTTGGTGTTCAACAACTTCTCGAGAAGTTGTTGAACACCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-395s1c1
Sequence:CCGGTGGAGCTGCATACGCACAATACTCGAGTATTGTGCGTATGCAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-286s21c1
Sequence:CCGGTACCTGCCCACTATGTCTATCCTCGAGGATAGACATAGTGGGCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-626s21c1
Sequence:CCGGGCAGACAGACCGAATGCAATACTCGAGTATTGCATTCGGTCTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-234s21c1
Sequence:CCGGGCCTTTGGTGTTCAACAACTTCTCGAGAAGTTGTTGAACACCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_153020.2-156s21c1
Sequence:CCGGCCCATCATTGATGGCAGAAAGCTCGAGCTTTCTGCCATCAATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_153020.2-1041s21c1
Sequence:CCGGGCGAGCAATATGTAGCTTGAACTCGAGTTCAAGCTACATATTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153020
VALIDATED
RBM24 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 24
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116197    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153020.1-1040s1c1
Sequence:CCGGGCGAGCAATATGTAGCTTGAACTCGAGTTCAAGCTACATATTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-260s1c1
Sequence:CCGGAGCCCTTATACAAAGACCTTTCTCGAGAAAGGTCTTTGTATAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-234s1c1
Sequence:CCGGGCCTTTGGTGTTCAACAACTTCTCGAGAAGTTGTTGAACACCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153020.1-395s1c1
Sequence:CCGGTGGAGCTGCATACGCACAATACTCGAGTATTGTGCGTATGCAGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-286s21c1
Sequence:CCGGTACCTGCCCACTATGTCTATCCTCGAGGATAGACATAGTGGGCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-626s21c1
Sequence:CCGGGCAGACAGACCGAATGCAATACTCGAGTATTGCATTCGGTCTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153020.2-234s21c1
Sequence:CCGGGCCTTTGGTGTTCAACAACTTCTCGAGAAGTTGTTGAACACCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_153020.2-156s21c1
Sequence:CCGGCCCATCATTGATGGCAGAAAGCTCGAGCTTTCTGCCATCAATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_153020.2-1041s21c1
Sequence:CCGGGCGAGCAATATGTAGCTTGAACTCGAGTTCAAGCTACATATTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081425
RBM24 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1277s21c1
Sequence:CCGGAGCTGCTGCAGGCTATGTAACCTCGAGGTTACATAGCCTGCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1162s21c1
Sequence:CCGGCTTCCACCACACCGTACATTGCTCGAGCAATGTACGGTGTGGTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081425.1-2655s21c1
Sequence:CCGGGGTCTAGATGTAGCATATTAACTCGAGTTAATATGCTACATCTAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-951s21c1
Sequence:CCGGCCCATCATCGATGGTAGGAAGCTCGAGCTTCCTACCATCGATGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1056s21c1
Sequence:CCGGGCCCTTATCCAGAGACCTTTCCTCGAGGAAAGGTCTCTGGATAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081425
RBM24 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1277s21c1
Sequence:CCGGAGCTGCTGCAGGCTATGTAACCTCGAGGTTACATAGCCTGCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1162s21c1
Sequence:CCGGCTTCCACCACACCGTACATTGCTCGAGCAATGTACGGTGTGGTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081425.1-2655s21c1
Sequence:CCGGGGTCTAGATGTAGCATATTAACTCGAGTTAATATGCTACATCTAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-951s21c1
Sequence:CCGGCCCATCATCGATGGTAGGAAGCTCGAGCTTCCTACCATCGATGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1056s21c1
Sequence:CCGGGCCCTTATCCAGAGACCTTTCCTCGAGGAAAGGTCTCTGGATAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081425
RBM24 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1277s21c1
Sequence:CCGGAGCTGCTGCAGGCTATGTAACCTCGAGGTTACATAGCCTGCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1162s21c1
Sequence:CCGGCTTCCACCACACCGTACATTGCTCGAGCAATGTACGGTGTGGTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081425.1-2655s21c1
Sequence:CCGGGGTCTAGATGTAGCATATTAACTCGAGTTAATATGCTACATCTAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-951s21c1
Sequence:CCGGCCCATCATCGATGGTAGGAAGCTCGAGCTTCCTACCATCGATGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081425.1-1056s21c1
Sequence:CCGGGCCCTTATCCAGAGACCTTTCCTCGAGGAAAGGTCTCTGGATAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)