EMAIL THIS PAGE TO A FRIEND

RBM25

RNA binding motif protein 25

295 Gene Product Result for
Synonyms: NET52 RED120 RNPC7 S164 Snu71 fSAP94
Gene ID:
Mouse(67039) RNA binding motif protein 25
Rat(366693) RNA binding motif protein 25
Zebrafish(327336) RNA binding motif protein 25
chicken(423250) RNA binding motif protein 25
dog(610314) RNA binding motif protein 25
domestic cat(101086982) RNA binding motif protein 25
Horse(100055577) RNA binding motif protein 25
cow(540258) RNA binding motif protein 25
sheep(101101988) RNA binding motif protein 25
domestic guinea pig(100727871) RNA binding motif protein 25
naked mole-rat(101716537) RNA binding motif protein 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027349 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027349 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027349 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021239 Rosetta Predictions human pricing
NM_001108984 Rosetta Predictions rat pricing
NM_027349 Rosetta Predictions mouse pricing
XM_619008 Rosetta Predictions mouse pricing
XM_899912 Rosetta Predictions mouse pricing
XM_899918 Rosetta Predictions mouse pricing
XM_899944 Rosetta Predictions mouse pricing
XM_899951 Rosetta Predictions mouse pricing
XM_899969 Rosetta Predictions mouse pricing
XM_899976 Rosetta Predictions mouse pricing
XM_899982 Rosetta Predictions mouse pricing
XM_899986 Rosetta Predictions mouse pricing
XM_899997 Rosetta Predictions mouse pricing
XM_900002 Rosetta Predictions mouse pricing
XM_900007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125374 predicted 2461
2 SASI_Hs01_00125375 predicted 2288
3 SASI_Hs02_00354877 predicted 2542
4 SASI_Hs01_00125376 predicted 2488
5 SASI_Hs01_00125378 predicted 2229
6 SASI_Hs01_00125379 predicted 2518
7 SASI_Hs02_00354878 predicted 2435
8 SASI_Hs01_00125380 predicted 508
9 SASI_Hs01_00125381 predicted 2546
10 SASI_Hs01_00125382 predicted 678
11 SASI_Hs01_00125377 predicted 2440
12 SASI_Hs01_00125383 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244024 predicted 627
2 SASI_Rn02_00244025 predicted 786
3 SASI_Rn02_00244026 predicted 476
4 SASI_Rn02_00244027 predicted 297
5 SASI_Rn02_00244028 predicted 497
6 SASI_Rn02_00244029 predicted 733
7 SASI_Rn02_00244030 predicted 759
8 SASI_Rn02_00244031 predicted 669
9 SASI_Rn02_00244032 predicted 682
10 SASI_Rn02_00244033 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332006 predicted 493
2 SASI_Mm02_00332007 predicted 800
3 SASI_Mm02_00332008 predicted 2536
4 SASI_Mm02_00332009 predicted 504
5 SASI_Mm02_00332010 predicted 746
6 SASI_Mm02_00332011 predicted 2231
7 SASI_Mm02_00332012 predicted 2460
8 SASI_Mm02_00332013 predicted 2565
9 SASI_Mm02_00332014 predicted 396
10 SASI_Mm02_00332015 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252835 predicted 2620
2 SASI_Mm01_00252836 predicted 2551
3 SASI_Mm01_00252837 predicted 2438
4 SASI_Mm01_00252838 predicted 2109
5 SASI_Mm01_00252839 predicted 2133
6 SASI_Mm01_00252840 predicted 2463
7 SASI_Mm01_00252841 predicted 2477
8 SASI_Mm01_00252842 predicted 2620
9 SASI_Mm01_00252843 predicted 2085
10 SASI_Mm01_00252844 predicted 2147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232375 predicted 504
2 SASI_Mm01_00232376 predicted 657
3 SASI_Mm01_00232377 predicted 585
4 SASI_Mm01_00232378 predicted 811
5 SASI_Mm01_00232379 predicted 569
6 SASI_Mm01_00232380 predicted 503
7 SASI_Mm01_00232381 predicted 526
8 SASI_Mm01_00232382 predicted 767
9 SASI_Mm01_00232383 predicted 689
10 SASI_Mm01_00232384 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257977 predicted 2959
2 SASI_Mm01_00257978 predicted 2896
3 SASI_Mm01_00257979 predicted 2776
4 SASI_Mm01_00257980 predicted 2461
5 SASI_Mm01_00257981 predicted 2480
6 SASI_Mm01_00257982 predicted 2800
7 SASI_Mm01_00257983 predicted 2815
8 SASI_Mm01_00257984 predicted 2970
9 SASI_Mm01_00257985 predicted 2430
10 SASI_Mm01_00257986 predicted 2500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238592 predicted 2744
2 SASI_Mm01_00238593 predicted 2676
3 SASI_Mm01_00238594 predicted 2552
4 SASI_Mm01_00238595 predicted 2239
5 SASI_Mm01_00238596 predicted 2259
6 SASI_Mm01_00238597 predicted 2576
7 SASI_Mm01_00238598 predicted 2599
8 SASI_Mm01_00238599 predicted 2749
9 SASI_Mm01_00238600 predicted 2206
10 SASI_Mm01_00238601 predicted 2267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205144 predicted 507
2 SASI_Mm01_00205145 predicted 1191
3 SASI_Mm01_00205146 predicted 1093
4 SASI_Mm01_00205147 predicted 1183
5 SASI_Mm01_00205148 predicted 817
6 SASI_Mm01_00205149 predicted 1187
7 SASI_Mm01_00205150 predicted 1147
8 SASI_Mm01_00205151 predicted 1056
9 SASI_Mm01_00205152 predicted 529
10 SASI_Mm01_00205153 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899969 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272605 predicted 2904
2 SASI_Mm01_00272606 predicted 2844
3 SASI_Mm01_00272607 predicted 2722
4 SASI_Mm01_00272608 predicted 2409
5 SASI_Mm01_00272609 predicted 2426
6 SASI_Mm01_00272610 predicted 2746
7 SASI_Mm01_00272611 predicted 2770
8 SASI_Mm01_00272612 predicted 2918
9 SASI_Mm01_00272613 predicted 2378
10 SASI_Mm01_00272614 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235642 predicted 2881
2 SASI_Mm01_00235643 predicted 2822
3 SASI_Mm01_00235644 predicted 2698
4 SASI_Mm01_00235645 predicted 2383
5 SASI_Mm01_00235646 predicted 2399
6 SASI_Mm01_00235647 predicted 2723
7 SASI_Mm01_00235648 predicted 2743
8 SASI_Mm01_00235649 predicted 2898
9 SASI_Mm01_00235650 predicted 2354
10 SASI_Mm01_00235651 predicted 2412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255470 predicted 2816
2 SASI_Mm01_00255471 predicted 2760
3 SASI_Mm01_00255472 predicted 2633
4 SASI_Mm01_00255473 predicted 2310
5 SASI_Mm01_00255474 predicted 2330
6 SASI_Mm01_00255475 predicted 2664
7 SASI_Mm01_00255476 predicted 2677
8 SASI_Mm01_00255477 predicted 2824
9 SASI_Mm01_00255478 predicted 2282
10 SASI_Mm01_00255479 predicted 2345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221181 predicted 2820
2 SASI_Mm01_00221182 predicted 2753
3 SASI_Mm01_00221183 predicted 2634
4 SASI_Mm01_00221184 predicted 2314
5 SASI_Mm01_00221185 predicted 2331
6 SASI_Mm01_00221186 predicted 2658
7 SASI_Mm01_00221187 predicted 2676
8 SASI_Mm01_00221188 predicted 2831
9 SASI_Mm01_00221189 predicted 2289
10 SASI_Mm01_00221190 predicted 2356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275214 predicted 2776
2 SASI_Mm01_00275215 predicted 2714
3 SASI_Mm01_00275216 predicted 2597
4 SASI_Mm01_00275217 predicted 2278
5 SASI_Mm01_00275218 predicted 2290
6 SASI_Mm01_00275219 predicted 2622
7 SASI_Mm01_00275220 predicted 2637
8 SASI_Mm01_00275221 predicted 2789
9 SASI_Mm01_00275222 predicted 2243
10 SASI_Mm01_00275223 predicted 2311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900002 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266604 predicted 2750
2 SASI_Mm01_00266605 predicted 2687
3 SASI_Mm01_00266606 predicted 2566
4 SASI_Mm01_00266607 predicted 2244
5 SASI_Mm01_00266608 predicted 2268
6 SASI_Mm01_00266609 predicted 2590
7 SASI_Mm01_00266610 predicted 2611
8 SASI_Mm01_00266611 predicted 2765
9 SASI_Mm01_00266612 predicted 2219
10 SASI_Mm01_00266613 predicted 2280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209706 predicted 2820
2 SASI_Mm01_00209707 predicted 2752
3 SASI_Mm01_00209708 predicted 2640
4 SASI_Mm01_00209709 predicted 2310
5 SASI_Mm01_00209710 predicted 2339
6 SASI_Mm01_00209711 predicted 2664
7 SASI_Mm01_00209712 predicted 2671
8 SASI_Mm01_00209713 predicted 2824
9 SASI_Mm01_00209714 predicted 2286
10 SASI_Mm01_00209715 predicted 2349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027349
VALIDATED
RBM25 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027349.3-2437s21c1
Sequence:CCGGGCTCTTTGCTTATCCTTTGGACTCGAGTCCAAAGGATAAGCAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027349.3-2493s21c1
Sequence:CCGGGAATCCGGCCATGGATCAATACTCGAGTATTGATCCATGGCCGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027349.3-507s21c1
Sequence:CCGGTACGACAGCTCTTAGCTAAATCTCGAGATTTAGCTAAGAGCTGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027349.3-969s21c1
Sequence:CCGGTCATCACCAAGGAGGATATAACTCGAGTTATATCCTCCTTGGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027349.3-3989s21c1
Sequence:CCGGGCTGCCATGTTTGCTTACTAACTCGAGTTAGTAAGCAAACATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027349
VALIDATED
RBM25 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027349.3-2437s21c1
Sequence:CCGGGCTCTTTGCTTATCCTTTGGACTCGAGTCCAAAGGATAAGCAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027349.3-2493s21c1
Sequence:CCGGGAATCCGGCCATGGATCAATACTCGAGTATTGATCCATGGCCGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027349.3-507s21c1
Sequence:CCGGTACGACAGCTCTTAGCTAAATCTCGAGATTTAGCTAAGAGCTGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027349.3-969s21c1
Sequence:CCGGTCATCACCAAGGAGGATATAACTCGAGTTATATCCTCCTTGGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027349.3-3989s21c1
Sequence:CCGGGCTGCCATGTTTGCTTACTAACTCGAGTTAGTAAGCAAACATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027349
VALIDATED
RBM25 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027349.3-2437s21c1
Sequence:CCGGGCTCTTTGCTTATCCTTTGGACTCGAGTCCAAAGGATAAGCAAAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000329584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027349.3-2493s21c1
Sequence:CCGGGAATCCGGCCATGGATCAATACTCGAGTATTGATCCATGGCCGGATTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000329654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027349.3-507s21c1
Sequence:CCGGTACGACAGCTCTTAGCTAAATCTCGAGATTTAGCTAAGAGCTGTCGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000329583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027349.3-969s21c1
Sequence:CCGGTCATCACCAAGGAGGATATAACTCGAGTTATATCCTCCTTGGTGATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027349.3-3989s21c1
Sequence:CCGGGCTGCCATGTTTGCTTACTAACTCGAGTTAGTAAGCAAACATGGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021239
VALIDATED
RBM25 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-2558s21c1
Sequence:CCGGGGTGAAGAAGAAGCTACATTACTCGAGTAATGTAGCTTCTTCTTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-2941s21c1
Sequence:CCGGTTATACTCACCAGGTACAAATCTCGAGATTTGTACCTGGTGAGTATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-1585s21c1
Sequence:CCGGGCGCCTTAAGAATTGGGAAATCTCGAGATTTCCCAATTCTTAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021239.2-981s21c1
Sequence:CCGGTCATCACTAAGGAGGATATAACTCGAGTTATATCCTCCTTAGTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021239.1-665s1c1
Sequence:CCGGGCTGGATGAATGGAAAGCAAACTCGAGTTTGCTTTCCATTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021239.1-3731s1c1
Sequence:CCGGCGGCAATTTGTAAGTTTACATCTCGAGATGTAAACTTACAAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021239.1-375s1c1
Sequence:CCGGCCAGGCTTAAAGGCTAAAGAACTCGAGTTCTTTAGCCTTTAAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021239.1-1538s1c1
Sequence:CCGGGCGCCTTAAGAATTGGGAAATCTCGAGATTTCCCAATTCTTAAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021239.1-2466s1c1
Sequence:CCGGCGTCGAATTAGACCATGGATTCTCGAGAATCCATGGTCTAATTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021239
VALIDATED
RBM25 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-2558s21c1
Sequence:CCGGGGTGAAGAAGAAGCTACATTACTCGAGTAATGTAGCTTCTTCTTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-2941s21c1
Sequence:CCGGTTATACTCACCAGGTACAAATCTCGAGATTTGTACCTGGTGAGTATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-1585s21c1
Sequence:CCGGGCGCCTTAAGAATTGGGAAATCTCGAGATTTCCCAATTCTTAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021239.2-981s21c1
Sequence:CCGGTCATCACTAAGGAGGATATAACTCGAGTTATATCCTCCTTAGTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021239.1-665s1c1
Sequence:CCGGGCTGGATGAATGGAAAGCAAACTCGAGTTTGCTTTCCATTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021239.1-3731s1c1
Sequence:CCGGCGGCAATTTGTAAGTTTACATCTCGAGATGTAAACTTACAAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021239.1-375s1c1
Sequence:CCGGCCAGGCTTAAAGGCTAAAGAACTCGAGTTCTTTAGCCTTTAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021239.1-1538s1c1
Sequence:CCGGGCGCCTTAAGAATTGGGAAATCTCGAGATTTCCCAATTCTTAAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021239.1-2466s1c1
Sequence:CCGGCGTCGAATTAGACCATGGATTCTCGAGAATCCATGGTCTAATTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021239
VALIDATED
RBM25 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-2558s21c1
Sequence:CCGGGGTGAAGAAGAAGCTACATTACTCGAGTAATGTAGCTTCTTCTTCACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294108    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-2941s21c1
Sequence:CCGGTTATACTCACCAGGTACAAATCTCGAGATTTGTACCTGGTGAGTATAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000286633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021239.2-1585s21c1
Sequence:CCGGGCGCCTTAAGAATTGGGAAATCTCGAGATTTCCCAATTCTTAAGGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000294109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021239.2-981s21c1
Sequence:CCGGTCATCACTAAGGAGGATATAACTCGAGTTATATCCTCCTTAGTGATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021239.1-665s1c1
Sequence:CCGGGCTGGATGAATGGAAAGCAAACTCGAGTTTGCTTTCCATTCATCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021239.1-3731s1c1
Sequence:CCGGCGGCAATTTGTAAGTTTACATCTCGAGATGTAAACTTACAAATTGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021239.1-375s1c1
Sequence:CCGGCCAGGCTTAAAGGCTAAAGAACTCGAGTTCTTTAGCCTTTAAGCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021239.1-1538s1c1
Sequence:CCGGGCGCCTTAAGAATTGGGAAATCTCGAGATTTCCCAATTCTTAAGGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021239.1-2466s1c1
Sequence:CCGGCGTCGAATTAGACCATGGATTCTCGAGAATCCATGGTCTAATTCGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025930
RBM25 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 25
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025930.2-1515s1c1
Sequence:CCGGGCCAACATGAATAAGTTGAATCTCGAGATTCAACTTATTCATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025930.2-2422s1c1
Sequence:CCGGGCTGCCATGTTTGCTTACTAACTCGAGTTAGTAAGCAAACATGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-878s1c1
Sequence:CCGGGCTTATCCTTTGGATTGGTCTCTCGAGAGACCAATCCAAAGGATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.3-1534s1c1
Sequence:CCGGGATAGTGTCTTTAACAAATTCCTCGAGGAATTTGTTAAAGACACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.3-1381s1c1
Sequence:CCGGGAGTCTCCTTGTGGTATTATTCTCGAGAATAATACCACAAGGAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-1002s1c1
Sequence:CCGGGCTCTAAGGTTATGGCACATACTCGAGTATGTGCCATAACCTTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-871s1c1
Sequence:CCGGGCTCTTTGCTTATCCTTTGGACTCGAGTCCAAAGGATAAGCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025930
RBM25 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 25
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025930.2-1515s1c1
Sequence:CCGGGCCAACATGAATAAGTTGAATCTCGAGATTCAACTTATTCATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025930.2-2422s1c1
Sequence:CCGGGCTGCCATGTTTGCTTACTAACTCGAGTTAGTAAGCAAACATGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-878s1c1
Sequence:CCGGGCTTATCCTTTGGATTGGTCTCTCGAGAGACCAATCCAAAGGATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.3-1534s1c1
Sequence:CCGGGATAGTGTCTTTAACAAATTCCTCGAGGAATTTGTTAAAGACACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.3-1381s1c1
Sequence:CCGGGAGTCTCCTTGTGGTATTATTCTCGAGAATAATACCACAAGGAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-1002s1c1
Sequence:CCGGGCTCTAAGGTTATGGCACATACTCGAGTATGTGCCATAACCTTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-871s1c1
Sequence:CCGGGCTCTTTGCTTATCCTTTGGACTCGAGTCCAAAGGATAAGCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025930
RBM25 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 25
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025930.2-1515s1c1
Sequence:CCGGGCCAACATGAATAAGTTGAATCTCGAGATTCAACTTATTCATGTTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025930.2-2422s1c1
Sequence:CCGGGCTGCCATGTTTGCTTACTAACTCGAGTTAGTAAGCAAACATGGCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000176013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-878s1c1
Sequence:CCGGGCTTATCCTTTGGATTGGTCTCTCGAGAGACCAATCCAAAGGATAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.3-1534s1c1
Sequence:CCGGGATAGTGTCTTTAACAAATTCCTCGAGGAATTTGTTAAAGACACTATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.3-1381s1c1
Sequence:CCGGGAGTCTCCTTGTGGTATTATTCTCGAGAATAATACCACAAGGAGACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000194224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-1002s1c1
Sequence:CCGGGCTCTAAGGTTATGGCACATACTCGAGTATGTGCCATAACCTTAGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025930.2-871s1c1
Sequence:CCGGGCTCTTTGCTTATCCTTTGGACTCGAGTCCAAAGGATAAGCAAAGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???