EMAIL THIS PAGE TO A FRIEND

RBM26

RNA binding motif protein 26

84 Gene Product Result for
Synonyms: ARRS2 C13orf10 RP11-255E21.1 SE70-2 ZC3H17
Gene ID:
Mouse(74213) RNA binding motif protein 26
naked mole-rat(101708286) RNA binding motif protein 26
domestic guinea pig(100724880) RNA binding motif protein 26
cow(504409) RNA binding motif protein 26
sheep(101104159) RNA binding motif protein 26
chicken(418804) RNA binding motif protein 26
dog(476955) RNA binding motif protein 26
Horse(100050021) RNA binding motif protein 26
domestic cat(101087633) RNA binding motif protein 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101956 Anti-RBM26 antibody produced in rabbit affinity isolated antibody pig, dog, rat, human, bovine, horse, mouse, rabbit
western blot pricing
HPA040252 Anti-RBM26 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502730 Anti-RBM26 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022118 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022118 Rosetta Predictions human pricing
NM_134077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355512 predicted 755
2 SASI_Hs01_00127469 predicted 2957
3 SASI_Hs01_00127470 predicted 1567
4 SASI_Hs01_00127471 predicted 675
5 SASI_Hs01_00127472 predicted 1773
6 SASI_Hs01_00127473 predicted 396
7 SASI_Hs01_00127475 predicted 2757
8 SASI_Hs01_00127476 predicted 847
9 SASI_Hs01_00127477 predicted 2979
10 SASI_Hs02_00355513 predicted 2926
11 SASI_Hs01_00127468 predicted 2701
12 SASI_Hs01_00127474 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108190 predicted 1310
2 SASI_Mm01_00108192 predicted 2246
3 SASI_Mm02_00339284 predicted 3429
4 SASI_Mm01_00108193 predicted 1849
5 SASI_Mm01_00108194 predicted 1218
6 SASI_Mm01_00108197 predicted 1199
7 SASI_Mm02_00339285 predicted 3101
8 SASI_Mm01_00108198 predicted 1131
9 SASI_Mm01_00108199 predicted 2293
10 SASI_Mm02_00339286 predicted 1258
11 SASI_Mm01_00108191 predicted 947
12 SASI_Mm01_00108195 predicted 637
13 SASI_Mm01_00108196 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022118
VALIDATED
RBM26 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 26
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-1788s1c1
Sequence:CCGGGCAGTATTAAACAATCGCTTTCTCGAGAAAGCGATTGTTTAATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-1840s1c1
Sequence:CCGGCCCAACAGTTACAAACTACTTCTCGAGAAGTAGTTTGTAACTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022118.3-3431s1c1
Sequence:CCGGGCTTAGGCTTTACTATGTATTCTCGAGAATACATAGTAAAGCCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-2769s1c1
Sequence:CCGGGCTCGTTTCAAAGGGCAAGATCTCGAGATCTTGCCCTTTGAAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-677s1c1
Sequence:CCGGCCTGGATAGAACAGATCCATTCTCGAGAATGGATCTGTTCTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022118.3-747s21c1
Sequence:CCGGCACTACCCTGTACCTACTTTGCTCGAGCAAAGTAGGTACAGGGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022118.3-2802s21c1
Sequence:CCGGTGGAATAAACCAGTAACTAATCTCGAGATTAGTTACTGGTTTATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-2993s21c1
Sequence:CCGGTACCTGTGTTTCATTAGTATTCTCGAGAATACTAATGAAACACAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-1788s21c1
Sequence:CCGGGCAGTATTAAACAATCGCTTTCTCGAGAAAGCGATTGTTTAATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-1840s21c1
Sequence:CCGGCCCAACAGTTACAAACTACTTCTCGAGAAGTAGTTTGTAACTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022118
VALIDATED
RBM26 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 26
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-1788s1c1
Sequence:CCGGGCAGTATTAAACAATCGCTTTCTCGAGAAAGCGATTGTTTAATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-1840s1c1
Sequence:CCGGCCCAACAGTTACAAACTACTTCTCGAGAAGTAGTTTGTAACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022118.3-3431s1c1
Sequence:CCGGGCTTAGGCTTTACTATGTATTCTCGAGAATACATAGTAAAGCCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-2769s1c1
Sequence:CCGGGCTCGTTTCAAAGGGCAAGATCTCGAGATCTTGCCCTTTGAAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-677s1c1
Sequence:CCGGCCTGGATAGAACAGATCCATTCTCGAGAATGGATCTGTTCTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022118.3-747s21c1
Sequence:CCGGCACTACCCTGTACCTACTTTGCTCGAGCAAAGTAGGTACAGGGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022118.3-2802s21c1
Sequence:CCGGTGGAATAAACCAGTAACTAATCTCGAGATTAGTTACTGGTTTATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-2993s21c1
Sequence:CCGGTACCTGTGTTTCATTAGTATTCTCGAGAATACTAATGAAACACAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-1788s21c1
Sequence:CCGGGCAGTATTAAACAATCGCTTTCTCGAGAAAGCGATTGTTTAATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-1840s21c1
Sequence:CCGGCCCAACAGTTACAAACTACTTCTCGAGAAGTAGTTTGTAACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022118
VALIDATED
RBM26 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 26
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-1788s1c1
Sequence:CCGGGCAGTATTAAACAATCGCTTTCTCGAGAAAGCGATTGTTTAATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-1840s1c1
Sequence:CCGGCCCAACAGTTACAAACTACTTCTCGAGAAGTAGTTTGTAACTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022118.3-3431s1c1
Sequence:CCGGGCTTAGGCTTTACTATGTATTCTCGAGAATACATAGTAAAGCCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-2769s1c1
Sequence:CCGGGCTCGTTTCAAAGGGCAAGATCTCGAGATCTTGCCCTTTGAAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022118.3-677s1c1
Sequence:CCGGCCTGGATAGAACAGATCCATTCTCGAGAATGGATCTGTTCTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022118.3-747s21c1
Sequence:CCGGCACTACCCTGTACCTACTTTGCTCGAGCAAAGTAGGTACAGGGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022118.3-2802s21c1
Sequence:CCGGTGGAATAAACCAGTAACTAATCTCGAGATTAGTTACTGGTTTATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-2993s21c1
Sequence:CCGGTACCTGTGTTTCATTAGTATTCTCGAGAATACTAATGAAACACAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-1788s21c1
Sequence:CCGGGCAGTATTAAACAATCGCTTTCTCGAGAAAGCGATTGTTTAATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_022118.3-1840s21c1
Sequence:CCGGCCCAACAGTTACAAACTACTTCTCGAGAAGTAGTTTGTAACTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134077
RBM26 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 26
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-965s21c1
Sequence:CCGGTCATATAGAGACCGGTATAACCTCGAGGTTATACCGGTCTCTATATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134077.3-3617s1c1
Sequence:CCGGCCACAGGAAATCTTGTAATAACTCGAGTTATTACAAGATTTCCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-1700s1c1
Sequence:CCGGCCAGATACATACGATACAGATCTCGAGATCTGTATCGTATGTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-635s1c1
Sequence:CCGGGCTGTGAATACAAAGAGTTATCTCGAGATAACTCTTTGTATTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-2145s1c1
Sequence:CCGGCCCTTATTCAATTCGCAACTTCTCGAGAAGTTGCGAATTGAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-3205s1c1
Sequence:CCGGCCATGCAATAATCACATTCAACTCGAGTTGAATGTGATTATTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-2193s21c1
Sequence:CCGGCCCTTATTCAATTCGCAACTTCTCGAGAAGTTGCGAATTGAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-698s21c1
Sequence:CCGGGCTGTGAATACAAAGAGTTATCTCGAGATAACTCTTTGTATTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-1252s21c1
Sequence:CCGGTCCTACTCATCACGGTAATAACTCGAGTTATTACCGTGATGAGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134077.4-3463s21c1
Sequence:CCGGTACCTGTGTTTCATTAGTATTCTCGAGAATACTAATGAAACACAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134077
RBM26 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 26
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-965s21c1
Sequence:CCGGTCATATAGAGACCGGTATAACCTCGAGGTTATACCGGTCTCTATATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134077.3-3617s1c1
Sequence:CCGGCCACAGGAAATCTTGTAATAACTCGAGTTATTACAAGATTTCCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-1700s1c1
Sequence:CCGGCCAGATACATACGATACAGATCTCGAGATCTGTATCGTATGTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-635s1c1
Sequence:CCGGGCTGTGAATACAAAGAGTTATCTCGAGATAACTCTTTGTATTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-2145s1c1
Sequence:CCGGCCCTTATTCAATTCGCAACTTCTCGAGAAGTTGCGAATTGAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-3205s1c1
Sequence:CCGGCCATGCAATAATCACATTCAACTCGAGTTGAATGTGATTATTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-2193s21c1
Sequence:CCGGCCCTTATTCAATTCGCAACTTCTCGAGAAGTTGCGAATTGAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-698s21c1
Sequence:CCGGGCTGTGAATACAAAGAGTTATCTCGAGATAACTCTTTGTATTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-1252s21c1
Sequence:CCGGTCCTACTCATCACGGTAATAACTCGAGTTATTACCGTGATGAGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134077.4-3463s21c1
Sequence:CCGGTACCTGTGTTTCATTAGTATTCTCGAGAATACTAATGAAACACAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134077
RBM26 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 26
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-965s21c1
Sequence:CCGGTCATATAGAGACCGGTATAACCTCGAGGTTATACCGGTCTCTATATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134077.3-3617s1c1
Sequence:CCGGCCACAGGAAATCTTGTAATAACTCGAGTTATTACAAGATTTCCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-1700s1c1
Sequence:CCGGCCAGATACATACGATACAGATCTCGAGATCTGTATCGTATGTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-635s1c1
Sequence:CCGGGCTGTGAATACAAAGAGTTATCTCGAGATAACTCTTTGTATTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-2145s1c1
Sequence:CCGGCCCTTATTCAATTCGCAACTTCTCGAGAAGTTGCGAATTGAATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134077.3-3205s1c1
Sequence:CCGGCCATGCAATAATCACATTCAACTCGAGTTGAATGTGATTATTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-2193s21c1
Sequence:CCGGCCCTTATTCAATTCGCAACTTCTCGAGAAGTTGCGAATTGAATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-698s21c1
Sequence:CCGGGCTGTGAATACAAAGAGTTATCTCGAGATAACTCTTTGTATTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134077.4-1252s21c1
Sequence:CCGGTCCTACTCATCACGGTAATAACTCGAGTTATTACCGTGATGAGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134077.4-3463s21c1
Sequence:CCGGTACCTGTGTTTCATTAGTATTCTCGAGAATACTAATGAAACACAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)