EMAIL THIS PAGE TO A FRIEND

RBM28

RNA binding motif protein 28

89 Gene Product Result for
UniProtKB ID: Q9NW13, A4D100, B4DU52, E9PDD9, Q53H65, Q96CV3
Gene ID:
Human(55131) Summary: The protein encoded by this gene is a specific nucleolar component of the spliceosomal small nuclear ribonucleoprotein (snRNP)complexes . It specifically associates with U1, U2, U4, U5, and U6 small nuclear RNAs (snRNAs), possibly coordinating their transition through the nucleolus. Mutation in this gene causes alopecia, progressive neurological defects, and endocrinopathy (ANE syndrome), a pleiotropic and clinically heterogeneous disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(68272) RNA binding motif protein 28
Rat(312182) RNA binding motif protein 28
Domestic Rabbit(100338231) RNA binding motif protein 28
naked mole-rat(101721886) RNA binding motif protein 28
domestic guinea pig(100727521) RNA binding motif protein 28
cow(507132) RNA binding motif protein 28
sheep(101110499) RNA binding motif protein 28
Zebrafish(393291) RNA binding motif protein 28
Horse(100071725) RNA binding motif protein 28
dog(475203) RNA binding motif protein 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018077 Rosetta Predictions human pricing
NM_001107850 Rosetta Predictions rat pricing
NM_026650 Rosetta Predictions mouse pricing
NM_133925 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351228 predicted 1207
2 SASI_Hs01_00218380 predicted 1227
3 SASI_Hs01_00218381 predicted 1702
4 SASI_Hs01_00218382 predicted 2411
5 SASI_Hs01_00218383 predicted 443
6 SASI_Hs01_00218384 predicted 1658
7 SASI_Hs02_00351229 predicted 1799
8 SASI_Hs01_00218387 predicted 2368
9 SASI_Hs01_00218386 predicted 2325
10 SASI_Hs01_00218388 predicted 1079
11 SASI_Hs01_00218379 predicted 441
12 SASI_Hs01_00218385 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232895 predicted 1122
2 SASI_Rn02_00232896 predicted 1197
3 SASI_Rn02_00232897 predicted 2226
4 SASI_Rn02_00232898 predicted 1177
5 SASI_Rn02_00232899 predicted 1480
6 SASI_Rn02_00232900 predicted 2234
7 SASI_Rn02_00232901 predicted 1034
8 SASI_Rn02_00232902 predicted 2199
9 SASI_Rn02_00232903 predicted 1618
10 SASI_Rn02_00232904 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102004 predicted 1655
2 SASI_Mm01_00102005 predicted 1084
3 SASI_Mm01_00102006 predicted 1560
4 SASI_Mm01_00102007 predicted 1644
5 SASI_Mm01_00102008 predicted 1529
6 SASI_Mm01_00102009 predicted 553
7 SASI_Mm01_00102010 predicted 1015
8 SASI_Mm01_00102011 predicted 1136
9 SASI_Mm01_00102012 predicted 1665
10 SASI_Mm01_00102013 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339018 predicted 437
2 SASI_Mm01_00127048 predicted 1771
3 SASI_Mm02_00339019 predicted 1801
4 SASI_Mm02_00339020 predicted 1205
5 SASI_Mm02_00339021 predicted 1627
6 SASI_Mm02_00339022 predicted 1645
7 SASI_Mm01_00127050 predicted 2331
8 SASI_Mm02_00339023 predicted 436
9 SASI_Mm02_00339024 predicted 1178
10 SASI_Mm02_00339025 predicted 1395
11 SASI_Mm01_00127047 predicted 1720
12 SASI_Mm01_00127049 predicted 1620
13 SASI_Mm01_00127051 predicted 1600
14 SASI_Mm01_00127052 predicted 613
15 SASI_Mm01_00127053 predicted 1092
16 SASI_Mm01_00127054 predicted 1210
17 SASI_Mm01_00127055 predicted 1735
18 SASI_Mm01_00127056 predicted 1735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018077
VALIDATED
RBM28 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 28
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-1256s1c1
Sequence:CCGGGCCCAGTTCATGACTCAAGAACTCGAGTTCTTGAGTCATGAACTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-2360s1c1
Sequence:CCGGCCTCTTGCAAAGAGGAGCAAACTCGAGTTTGCTCCTCTTTGCAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-2276s1c1
Sequence:CCGGGCTAAGGGAAATAAGACGGAACTCGAGTTCCGTCTTATTTCCCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-611s1c1
Sequence:CCGGGAAGCAGGTAAAGCTCTCAAACTCGAGTTTGAGAGCTTTACCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2561s1c1
Sequence:CCGGCCTTTGATGTGTGGTTCGTTACTCGAGTAACGAACCACACATCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2577s1c1
Sequence:CCGGCGTTAGCCACAAAGAGAAATACTCGAGTATTTCTCTTTGTGGCTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2599s1c1
Sequence:CCGGCTGAAAGTCAACATGATGCTTCTCGAGAAGCATCATGTTGACTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-2622s21c1
Sequence:CCGGTGCATATTATCCAGATTATTGCTCGAGCAATAATCTGGATAATATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-467s21c1
Sequence:CCGGATTCGGAACCTGAGCTTTAAGCTCGAGCTTAAAGCTCAGGTTCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-679s21c1
Sequence:CCGGGGCCGTGGCAAAGGATAAATACTCGAGTATTTATCCTTTGCCACGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-445s21c1
Sequence:CCGGAGATAAGAAAGCCAGATTAATCTCGAGATTAATCTGGCTTTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-1184s21c1
Sequence:CCGGCAGTTTGGAGAACTCAAATATCTCGAGATATTTGAGTTCTCCAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018077
VALIDATED
RBM28 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 28
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-1256s1c1
Sequence:CCGGGCCCAGTTCATGACTCAAGAACTCGAGTTCTTGAGTCATGAACTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-2360s1c1
Sequence:CCGGCCTCTTGCAAAGAGGAGCAAACTCGAGTTTGCTCCTCTTTGCAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-2276s1c1
Sequence:CCGGGCTAAGGGAAATAAGACGGAACTCGAGTTCCGTCTTATTTCCCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-611s1c1
Sequence:CCGGGAAGCAGGTAAAGCTCTCAAACTCGAGTTTGAGAGCTTTACCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2561s1c1
Sequence:CCGGCCTTTGATGTGTGGTTCGTTACTCGAGTAACGAACCACACATCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2577s1c1
Sequence:CCGGCGTTAGCCACAAAGAGAAATACTCGAGTATTTCTCTTTGTGGCTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2599s1c1
Sequence:CCGGCTGAAAGTCAACATGATGCTTCTCGAGAAGCATCATGTTGACTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-2622s21c1
Sequence:CCGGTGCATATTATCCAGATTATTGCTCGAGCAATAATCTGGATAATATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-467s21c1
Sequence:CCGGATTCGGAACCTGAGCTTTAAGCTCGAGCTTAAAGCTCAGGTTCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-679s21c1
Sequence:CCGGGGCCGTGGCAAAGGATAAATACTCGAGTATTTATCCTTTGCCACGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-445s21c1
Sequence:CCGGAGATAAGAAAGCCAGATTAATCTCGAGATTAATCTGGCTTTCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-1184s21c1
Sequence:CCGGCAGTTTGGAGAACTCAAATATCTCGAGATATTTGAGTTCTCCAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018077
VALIDATED
RBM28 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 28
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-1256s1c1
Sequence:CCGGGCCCAGTTCATGACTCAAGAACTCGAGTTCTTGAGTCATGAACTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-2360s1c1
Sequence:CCGGCCTCTTGCAAAGAGGAGCAAACTCGAGTTTGCTCCTCTTTGCAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-2276s1c1
Sequence:CCGGGCTAAGGGAAATAAGACGGAACTCGAGTTCCGTCTTATTTCCCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018077.1-611s1c1
Sequence:CCGGGAAGCAGGTAAAGCTCTCAAACTCGAGTTTGAGAGCTTTACCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2561s1c1
Sequence:CCGGCCTTTGATGTGTGGTTCGTTACTCGAGTAACGAACCACACATCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2577s1c1
Sequence:CCGGCGTTAGCCACAAAGAGAAATACTCGAGTATTTCTCTTTGTGGCTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018077.1-2599s1c1
Sequence:CCGGCTGAAAGTCAACATGATGCTTCTCGAGAAGCATCATGTTGACTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-2622s21c1
Sequence:CCGGTGCATATTATCCAGATTATTGCTCGAGCAATAATCTGGATAATATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-467s21c1
Sequence:CCGGATTCGGAACCTGAGCTTTAAGCTCGAGCTTAAAGCTCAGGTTCCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-679s21c1
Sequence:CCGGGGCCGTGGCAAAGGATAAATACTCGAGTATTTATCCTTTGCCACGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-445s21c1
Sequence:CCGGAGATAAGAAAGCCAGATTAATCTCGAGATTAATCTGGCTTTCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018077.2-1184s21c1
Sequence:CCGGCAGTTTGGAGAACTCAAATATCTCGAGATATTTGAGTTCTCCAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026650
VALIDATED
RBM28 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026650.1-457s1c1
Sequence:CCGGCCAACAGTTTGGTGATCTTAACTCGAGTTAAGATCACCAAACTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-511s1c1
Sequence:CCGGGCATTCTAAAGGTTGTGCATTCTCGAGAATGCACAACCTTTAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026650.1-1728s1c1
Sequence:CCGGCCAGATGATACACACTTTCTTCTCGAGAAGAAAGTGTGTATCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-1556s1c1
Sequence:CCGGGCTAAGGAGAATAAGGCAGAACTCGAGTTCTGCCTTATTCTCCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-968s1c1
Sequence:CCGGCGGGACCTTAAAGGAGTTCATCTCGAGATGAACTCCTTTAAGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026650
VALIDATED
RBM28 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026650.1-457s1c1
Sequence:CCGGCCAACAGTTTGGTGATCTTAACTCGAGTTAAGATCACCAAACTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-511s1c1
Sequence:CCGGGCATTCTAAAGGTTGTGCATTCTCGAGAATGCACAACCTTTAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026650.1-1728s1c1
Sequence:CCGGCCAGATGATACACACTTTCTTCTCGAGAAGAAAGTGTGTATCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-1556s1c1
Sequence:CCGGGCTAAGGAGAATAAGGCAGAACTCGAGTTCTGCCTTATTCTCCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-968s1c1
Sequence:CCGGCGGGACCTTAAAGGAGTTCATCTCGAGATGAACTCCTTTAAGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026650
VALIDATED
RBM28 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026650.1-457s1c1
Sequence:CCGGCCAACAGTTTGGTGATCTTAACTCGAGTTAAGATCACCAAACTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-511s1c1
Sequence:CCGGGCATTCTAAAGGTTGTGCATTCTCGAGAATGCACAACCTTTAGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026650.1-1728s1c1
Sequence:CCGGCCAGATGATACACACTTTCTTCTCGAGAAGAAAGTGTGTATCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-1556s1c1
Sequence:CCGGGCTAAGGAGAATAAGGCAGAACTCGAGTTCTGCCTTATTCTCCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026650.1-968s1c1
Sequence:CCGGCGGGACCTTAAAGGAGTTCATCTCGAGATGAACTCCTTTAAGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133925
RBM28 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 28
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000449071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2549s21c1
Sequence:CCGGGAGTCTGTGATTGCAACTTAACTCGAGTTAAGTTGCAATCACAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2807s21c1
Sequence:CCGGTACTAAAGTAGTCTCTGAATGCTCGAGCATTCAGAGACTACTTTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133925.2-1315s21c1
Sequence:CCGGGACAGCTCAAGGTCGACTTAGCTCGAGCTAAGTCGACCTTGAGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2631s21c1
Sequence:CCGGCTGAATTGTAAAGATGCATATCTCGAGATATGCATCTTTACAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133925
RBM28 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 28
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000449071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2549s21c1
Sequence:CCGGGAGTCTGTGATTGCAACTTAACTCGAGTTAAGTTGCAATCACAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2807s21c1
Sequence:CCGGTACTAAAGTAGTCTCTGAATGCTCGAGCATTCAGAGACTACTTTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133925.2-1315s21c1
Sequence:CCGGGACAGCTCAAGGTCGACTTAGCTCGAGCTAAGTCGACCTTGAGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2631s21c1
Sequence:CCGGCTGAATTGTAAAGATGCATATCTCGAGATATGCATCTTTACAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133925
RBM28 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 28
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000449071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2549s21c1
Sequence:CCGGGAGTCTGTGATTGCAACTTAACTCGAGTTAAGTTGCAATCACAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2807s21c1
Sequence:CCGGTACTAAAGTAGTCTCTGAATGCTCGAGCATTCAGAGACTACTTTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133925.2-1315s21c1
Sequence:CCGGGACAGCTCAAGGTCGACTTAGCTCGAGCTAAGTCGACCTTGAGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133925.2-2631s21c1
Sequence:CCGGCTGAATTGTAAAGATGCATATCTCGAGATATGCATCTTTACAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)