EMAIL THIS PAGE TO A FRIEND

RBM38

RNA binding motif protein 38

77 Gene Product Result for
Synonyms: HSRNASEB RNPC1 SEB4B SEB4D dJ800J21.2
Gene ID:
Mouse(56190) RNA binding motif protein 38
Rat(366262) RNA binding motif protein 38
cow(533516) RNA binding motif protein 38
sheep(101104417) RNA binding motif protein 38
domestic guinea pig(100724532) RNA binding motif protein 38
naked mole-rat(101708030) RNA binding motif protein 38
Zebrafish(333991) RNA binding motif protein 38
dog(611796) RNA binding motif protein 38
domestic cat(101093675) RNA binding motif protein 38
chicken(768866) RNA binding motif protein 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409498 Anti-RBM38 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV40862 Anti-RBM38 antibody produced in rabbit affinity isolated antibody bovine, human, guinea pig, dog, mouse
immunohistochemistry, western blot pricing
SAB2104556 Anti-RBM38 antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_183425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183425 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076021 MISSION® esiRNA esiRNA targeting mouse Rbm38 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017495 Rosetta Predictions human pricing
NM_183425 Rosetta Predictions human pricing
NM_001108965 Rosetta Predictions rat pricing
NM_019547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017495 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042942 predicted 1298
2 SASI_Hs01_00042943 predicted 1056
3 SASI_Hs01_00042944 predicted 1085
4 SASI_Hs01_00042945 predicted 1113
5 SASI_Hs01_00042946 predicted 1057
6 SASI_Hs01_00042948 predicted 1293
7 SASI_Hs01_00042949 predicted 1334
8 SASI_Hs01_00042950 predicted 1086
9 SASI_Hs01_00042951 predicted 1330
10 SASI_Hs02_00350109 predicted 1141
11 SASI_Hs01_00042947 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159650 predicted 994
2 SASI_Hs01_00159651 predicted 1030
3 SASI_Hs02_00371332 predicted 996
4 SASI_Hs01_00159652 predicted 1025
5 SASI_Hs01_00159653 predicted 1625
6 SASI_Hs01_00159656 predicted 1055
7 SASI_Hs01_00159657 predicted 1547
8 SASI_Hs01_00159658 predicted 1854
9 SASI_Hs01_00159659 predicted 1340
10 SASI_Hs02_00371333 predicted 2238
11 SASI_Hs01_00159654 predicted 2226
12 SASI_Hs01_00159655 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243834 predicted 1017
2 SASI_Rn02_00243835 predicted 1563
3 SASI_Rn02_00243836 predicted 1202
4 SASI_Rn02_00243837 predicted 1526
5 SASI_Rn02_00243838 predicted 910
6 SASI_Rn02_00243839 predicted 939
7 SASI_Rn02_00243840 predicted 1045
8 SASI_Rn02_00243841 predicted 974
9 SASI_Rn02_00243842 predicted 938
10 SASI_Rn02_00243843 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198399 predicted 270
2 SASI_Mm02_00324589 predicted 495
3 SASI_Mm01_00198400 predicted 1243
4 SASI_Mm01_00198401 predicted 486
5 SASI_Mm01_00198402 predicted 520
6 SASI_Mm01_00198403 predicted 539
7 SASI_Mm01_00198404 predicted 412
8 SASI_Mm01_00198405 predicted 664
9 SASI_Mm01_00198406 predicted 391
10 SASI_Mm01_00198407 predicted 459
11 SASI_Mm01_00198398 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017495
VALIDATED
RBM38 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 38
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1312s1c1
Sequence:CCGGGAAACCTGAAAGCAAGAAGTTCTCGAGAACTTCTTGCTTTCAGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-733s21c1
Sequence:CCGGCTATGACCAGTACCCATACGCCTCGAGGCGTATGGGTACTGGTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-928s21c1
Sequence:CCGGTCACCTTCACAGCAGACAGAGCTCGAGCTCTGTCTGCTGTGAAGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-256s21c1
Sequence:CCGGGCAGAAGGACACCACGTTCACCTCGAGGTGAACGTGGTGTCCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-842s21c1
Sequence:CCGGACCACTTTCGTGCAGTACCAGCTCGAGCTGGTACTGCACGAAAGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-569s21c1
Sequence:CCGGACCTTGATCCAGCGGACTTACCTCGAGGTAAGTCCGCTGGATCAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1092s21c1
Sequence:CCGGTGTGTCTTGAGGGAGGACTTTCTCGAGAAAGTCCTCCCTCAAGACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1137s21c1
Sequence:CCGGGACGCAATCCCAGGTTCCTTGCTCGAGCAAGGAACCTGGGATTGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-317s21c1
Sequence:CCGGGCCTCGCTCAGGAAGTACTTCCTCGAGGAAGTACTTCCTGAGCGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1323s1c1
Sequence:CCGGGCAAGAAGTTAATGGACTGTTCTCGAGAACAGTCCATTAACTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1680s1c1
Sequence:CCGGGACGACGATAGTGTTTCTGTACTCGAGTACAGAAACACTATCGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1066s1c1
Sequence:CCGGCGGCTTCTCTTTAATCTAGGTCTCGAGACCTAGATTAAAGAGAAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1514s1c1
Sequence:CCGGCTTTCCAGTCATAGCACTGAACTCGAGTTCAGTGCTATGACTGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017495.4-1907s1c1
Sequence:CCGGGAAGGAAGTGATCCACAGCATCTCGAGATGCTGTGGATCACTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1286s21c1
Sequence:CCGGACTGTGCAGAGATGCCTGACTCTCGAGAGTCAGGCATCTCTGCACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017495
VALIDATED
RBM38 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 38
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1312s1c1
Sequence:CCGGGAAACCTGAAAGCAAGAAGTTCTCGAGAACTTCTTGCTTTCAGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-733s21c1
Sequence:CCGGCTATGACCAGTACCCATACGCCTCGAGGCGTATGGGTACTGGTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-928s21c1
Sequence:CCGGTCACCTTCACAGCAGACAGAGCTCGAGCTCTGTCTGCTGTGAAGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-256s21c1
Sequence:CCGGGCAGAAGGACACCACGTTCACCTCGAGGTGAACGTGGTGTCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-842s21c1
Sequence:CCGGACCACTTTCGTGCAGTACCAGCTCGAGCTGGTACTGCACGAAAGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-569s21c1
Sequence:CCGGACCTTGATCCAGCGGACTTACCTCGAGGTAAGTCCGCTGGATCAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1092s21c1
Sequence:CCGGTGTGTCTTGAGGGAGGACTTTCTCGAGAAAGTCCTCCCTCAAGACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1137s21c1
Sequence:CCGGGACGCAATCCCAGGTTCCTTGCTCGAGCAAGGAACCTGGGATTGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-317s21c1
Sequence:CCGGGCCTCGCTCAGGAAGTACTTCCTCGAGGAAGTACTTCCTGAGCGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1323s1c1
Sequence:CCGGGCAAGAAGTTAATGGACTGTTCTCGAGAACAGTCCATTAACTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1680s1c1
Sequence:CCGGGACGACGATAGTGTTTCTGTACTCGAGTACAGAAACACTATCGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1066s1c1
Sequence:CCGGCGGCTTCTCTTTAATCTAGGTCTCGAGACCTAGATTAAAGAGAAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1514s1c1
Sequence:CCGGCTTTCCAGTCATAGCACTGAACTCGAGTTCAGTGCTATGACTGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017495.4-1907s1c1
Sequence:CCGGGAAGGAAGTGATCCACAGCATCTCGAGATGCTGTGGATCACTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1286s21c1
Sequence:CCGGACTGTGCAGAGATGCCTGACTCTCGAGAGTCAGGCATCTCTGCACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017495
VALIDATED
RBM38 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 38
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1312s1c1
Sequence:CCGGGAAACCTGAAAGCAAGAAGTTCTCGAGAACTTCTTGCTTTCAGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-733s21c1
Sequence:CCGGCTATGACCAGTACCCATACGCCTCGAGGCGTATGGGTACTGGTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-928s21c1
Sequence:CCGGTCACCTTCACAGCAGACAGAGCTCGAGCTCTGTCTGCTGTGAAGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-256s21c1
Sequence:CCGGGCAGAAGGACACCACGTTCACCTCGAGGTGAACGTGGTGTCCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-842s21c1
Sequence:CCGGACCACTTTCGTGCAGTACCAGCTCGAGCTGGTACTGCACGAAAGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-569s21c1
Sequence:CCGGACCTTGATCCAGCGGACTTACCTCGAGGTAAGTCCGCTGGATCAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1092s21c1
Sequence:CCGGTGTGTCTTGAGGGAGGACTTTCTCGAGAAAGTCCTCCCTCAAGACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1137s21c1
Sequence:CCGGGACGCAATCCCAGGTTCCTTGCTCGAGCAAGGAACCTGGGATTGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017495.4-317s21c1
Sequence:CCGGGCCTCGCTCAGGAAGTACTTCCTCGAGGAAGTACTTCCTGAGCGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1323s1c1
Sequence:CCGGGCAAGAAGTTAATGGACTGTTCTCGAGAACAGTCCATTAACTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1680s1c1
Sequence:CCGGGACGACGATAGTGTTTCTGTACTCGAGTACAGAAACACTATCGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1066s1c1
Sequence:CCGGCGGCTTCTCTTTAATCTAGGTCTCGAGACCTAGATTAAAGAGAAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_017495.4-1514s1c1
Sequence:CCGGCTTTCCAGTCATAGCACTGAACTCGAGTTCAGTGCTATGACTGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155045    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017495.4-1907s1c1
Sequence:CCGGGAAGGAAGTGATCCACAGCATCTCGAGATGCTGTGGATCACTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017495.4-1286s21c1
Sequence:CCGGACTGTGCAGAGATGCCTGACTCTCGAGAGTCAGGCATCTCTGCACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019547
VALIDATED
RBM38 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 38
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019547.2-413s21c1
Sequence:CCGGACCCTAACCCTATCATCGATGCTCGAGCATCGATGATAGGGTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-1147s1c1
Sequence:CCGGCCTTAACTCTGGGACGTGTAACTCGAGTTACACGTCCCAGAGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-370s1c1
Sequence:CCGGCGCATCGCTCAGAAAGTACTTCTCGAGAAGTACTTTCTGAGCGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019547.1-488s1c1
Sequence:CCGGGCGGCTGATAGGGCTTGCAAACTCGAGTTTGCAAGCCCTATCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019547.1-596s1c1
Sequence:CCGGGCTGTTGGTGTGCAGCAACTACTCGAGTAGTTGCTGCACACCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-778s1c1
Sequence:CCGGGCCAGCCACTTACGACCAGTACTCGAGTACTGGTCGTAAGTGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-273s21c1
Sequence:CCGGCGCATCGCTCAGAAAGTACTTCTCGAGAAGTACTTTCTGAGCGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-1164s21c1
Sequence:CCGGGCCATGTCCTGCTGGGAATTTCTCGAGAAATTCCCAGCAGGACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-468s21c1
Sequence:CCGGTGCCAAGCCTAGGAGCTTACACTCGAGTGTAAGCTCCTAGGCTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-629s21c1
Sequence:CCGGCCTCGCCCTACCTTGAGTATACTCGAGTATACTCAAGGTAGGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019547
VALIDATED
RBM38 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 38
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019547.2-413s21c1
Sequence:CCGGACCCTAACCCTATCATCGATGCTCGAGCATCGATGATAGGGTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-1147s1c1
Sequence:CCGGCCTTAACTCTGGGACGTGTAACTCGAGTTACACGTCCCAGAGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-370s1c1
Sequence:CCGGCGCATCGCTCAGAAAGTACTTCTCGAGAAGTACTTTCTGAGCGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019547.1-488s1c1
Sequence:CCGGGCGGCTGATAGGGCTTGCAAACTCGAGTTTGCAAGCCCTATCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019547.1-596s1c1
Sequence:CCGGGCTGTTGGTGTGCAGCAACTACTCGAGTAGTTGCTGCACACCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-778s1c1
Sequence:CCGGGCCAGCCACTTACGACCAGTACTCGAGTACTGGTCGTAAGTGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-273s21c1
Sequence:CCGGCGCATCGCTCAGAAAGTACTTCTCGAGAAGTACTTTCTGAGCGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-1164s21c1
Sequence:CCGGGCCATGTCCTGCTGGGAATTTCTCGAGAAATTCCCAGCAGGACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-468s21c1
Sequence:CCGGTGCCAAGCCTAGGAGCTTACACTCGAGTGTAAGCTCCTAGGCTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-629s21c1
Sequence:CCGGCCTCGCCCTACCTTGAGTATACTCGAGTATACTCAAGGTAGGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019547
VALIDATED
RBM38 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 38
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019547.2-413s21c1
Sequence:CCGGACCCTAACCCTATCATCGATGCTCGAGCATCGATGATAGGGTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-1147s1c1
Sequence:CCGGCCTTAACTCTGGGACGTGTAACTCGAGTTACACGTCCCAGAGTTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-370s1c1
Sequence:CCGGCGCATCGCTCAGAAAGTACTTCTCGAGAAGTACTTTCTGAGCGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019547.1-488s1c1
Sequence:CCGGGCGGCTGATAGGGCTTGCAAACTCGAGTTTGCAAGCCCTATCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019547.1-596s1c1
Sequence:CCGGGCTGTTGGTGTGCAGCAACTACTCGAGTAGTTGCTGCACACCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019547.1-778s1c1
Sequence:CCGGGCCAGCCACTTACGACCAGTACTCGAGTACTGGTCGTAAGTGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-273s21c1
Sequence:CCGGCGCATCGCTCAGAAAGTACTTCTCGAGAAGTACTTTCTGAGCGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-1164s21c1
Sequence:CCGGGCCATGTCCTGCTGGGAATTTCTCGAGAAATTCCCAGCAGGACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-468s21c1
Sequence:CCGGTGCCAAGCCTAGGAGCTTACACTCGAGTGTAAGCTCCTAGGCTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019547.2-629s21c1
Sequence:CCGGCCTCGCCCTACCTTGAGTATACTCGAGTATACTCAAGGTAGGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183425
RBM38 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 38
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000155575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183425.1-487s1c1
Sequence:CCGGCAACGTGAACCTGGCATATCTCTCGAGAGATATGCCAGGTTCACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183425
RBM38 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 38
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000155575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183425.1-487s1c1
Sequence:CCGGCAACGTGAACCTGGCATATCTCTCGAGAGATATGCCAGGTTCACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183425
RBM38 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 38
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000155575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183425.1-487s1c1
Sequence:CCGGCAACGTGAACCTGGCATATCTCTCGAGAGATATGCCAGGTTCACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)