EMAIL THIS PAGE TO A FRIEND

RBM39

RNA binding motif protein 39

125 Gene Product Result for
Synonyms: CAPER CAPERalpha FSAP59 HCC1 RNPC2
Gene ID:
Human(9584) Summary: This gene encodes a member of the U2AF65 family of proteins. The encoded protein is found in the nucleus, where it co-localizes with core spliceosomal proteins. It has been shown to play a role in both steroid hormone receptor-mediated transcription and alternative splicing, and it is also a transcriptional coregulator of the viral oncoprotein v-Rel. Multiple transcript variants have been observed for this gene. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Aug 2011]
Mouse(170791) RNA binding motif protein 39
Rat(362251) RNA binding motif protein 39
chicken(428133) RNA binding motif protein 39
domestic cat(101099707) RNA binding motif protein 39
Horse(100054976) RNA binding motif protein 39
dog(477216) RNA binding motif protein 39
naked mole-rat(101723579) RNA binding motif protein 39
Domestic Rabbit(100328710) RNA binding motif protein 39
domestic guinea pig(100733778) RNA binding motif protein 39
cow(508722) RNA binding motif protein 39
sheep(101118375) RNA binding motif protein 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001591 Anti-RBM39 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101959 Anti-RBM39 antibody produced in rabbit affinity isolated antibody rabbit, human, rabbit, rat, canine, horse, bovine, mouse, guinea pig
western blot pricing
SAB2103105 Anti-RBM39 antibody produced in rabbit affinity isolated antibody rabbit, zebrafish, horse, canine, guinea pig, mouse, rabbit, bovine, human, rat
western blot pricing
SAB1411679 Anti-RBM39 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
WH0009584M1 Monoclonal Anti-RNPC2 antibody produced in mouse clone 4G8, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070351 MISSION® esiRNA esiRNA human RBM39 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004902 Rosetta Predictions human pricing
NM_184234 Rosetta Predictions human pricing
NM_184237 Rosetta Predictions human pricing
NM_184241 Rosetta Predictions human pricing
NM_184244 Rosetta Predictions human pricing
NM_001013207 Rosetta Predictions rat pricing
NM_133242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232187 predicted 1106
2 SASI_Hs02_00338551 predicted 590
3 SASI_Hs01_00232189 predicted 1214
4 SASI_Hs02_00338552 predicted 1181
5 SASI_Hs01_00232190 predicted 2011
6 SASI_Hs01_00232191 predicted 1959
7 SASI_Hs01_00232192 predicted 1201
8 SASI_Hs01_00232193 predicted 971
9 SASI_Hs01_00232194 predicted 761
10 SASI_Hs01_00232195 predicted 897
11 SASI_Hs01_00232188 predicted 1867
12 SASI_Hs01_00232196 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238595 predicted 1105
2 SASI_Hs02_00371356 predicted 591
3 SASI_Hs01_00238597 predicted 1217
4 SASI_Hs02_00371357 predicted 1177
5 SASI_Hs01_00238598 predicted 2027
6 SASI_Hs01_00238599 predicted 1979
7 SASI_Hs01_00238600 predicted 1201
8 SASI_Hs01_00238601 predicted 971
9 SASI_Hs01_00238602 predicted 753
10 SASI_Hs01_00238603 predicted 894
11 SASI_Hs01_00238596 predicted 1885
12 SASI_Hs01_00238604 predicted 2029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024330 predicted 1179
2 SASI_Hs01_00024331 predicted 1289
3 SASI_Hs01_00024332 predicted 2106
4 SASI_Hs01_00024333 predicted 1171
5 SASI_Hs01_00024334 predicted 2048
6 SASI_Hs01_00024335 predicted 1286
7 SASI_Hs01_00024336 predicted 1046
8 SASI_Hs01_00024337 predicted 2114
9 SASI_Hs01_00024338 predicted 979
10 SASI_Hs01_00024339 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131297 predicted 1183
2 SASI_Hs01_00131298 predicted 1287
3 SASI_Hs01_00131299 predicted 2086
4 SASI_Hs01_00131300 predicted 1171
5 SASI_Hs01_00131301 predicted 2033
6 SASI_Hs01_00131302 predicted 1287
7 SASI_Hs01_00131303 predicted 1047
8 SASI_Hs01_00131304 predicted 2094
9 SASI_Hs01_00131305 predicted 980
10 SASI_Hs01_00131306 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152433 predicted 1187
2 SASI_Hs01_00152434 predicted 1287
3 SASI_Hs01_00152435 predicted 2100
4 SASI_Hs01_00152436 predicted 1165
5 SASI_Hs01_00152437 predicted 2059
6 SASI_Hs01_00152438 predicted 1286
7 SASI_Hs01_00152439 predicted 1053
8 SASI_Hs01_00152440 predicted 2109
9 SASI_Hs01_00152441 predicted 973
10 SASI_Hs01_00152442 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059805 predicted 1239
2 SASI_Rn01_00059807 predicted 797
3 SASI_Rn02_00200996 predicted 1562
4 SASI_Rn01_00059809 predicted 1206
5 SASI_Rn01_00059811 predicted 1009
6 SASI_Rn01_00059812 predicted 1172
7 SASI_Rn01_00059813 predicted 1583
8 SASI_Rn01_00059814 predicted 1108
9 SASI_Rn02_00200997 predicted 1122
10 SASI_Rn02_00200998 predicted 1539
11 SASI_Rn01_00059806 predicted 1564
12 SASI_Rn01_00059808 predicted 1281
13 SASI_Rn01_00059810 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050355 predicted 910
2 SASI_Mm01_00050356 predicted 1240
3 SASI_Mm01_00050357 predicted 1384
4 SASI_Mm01_00050358 predicted 1202
5 SASI_Mm01_00050359 predicted 1118
6 SASI_Mm01_00050360 predicted 1328
7 SASI_Mm01_00050361 predicted 1699
8 SASI_Mm01_00050362 predicted 1655
9 SASI_Mm01_00050363 predicted 993
10 SASI_Mm01_00050364 predicted 1125
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004902
VALIDATED
RBM39 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 39
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-1851s1c1
Sequence:CCGGCCAACTTACCACAACCTGTTTCTCGAGAAACAGGTTGTGGTAAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004902.2-840s1c1
Sequence:CCGGCCAAGGGATTTGGAAGAGTTTCTCGAGAAACTCTTCCAAATCCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-1083s1c1
Sequence:CCGGGCTGGACCTATGAGGCTTTATCTCGAGATAAAGCCTCATAGGTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004902.2-1213s1c1
Sequence:CCGGCCAAGGGATATGGATTTATTACTCGAGTAATAAATCCATATCCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-547s1c1
Sequence:CCGGGCCGTGAAAGAAAGCGAAGTACTCGAGTACTTCGCTTTCTTTCACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004902.2-2389s21c1
Sequence:CCGGATCTTGCATTCTGATCAATTGCTCGAGCAATTGATCAGAATGCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004902.2-1338s21c1
Sequence:CCGGGCTTCGAGTGCTAGTTCATTTCTCGAGAAATGAACTAGCACTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004902.2-1135s21c1
Sequence:CCGGATATGCTTCGTGGGATCTTTGCTCGAGCAAAGATCCCACGAAGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004902.2-965s21c1
Sequence:CCGGGCCTCTAGCAATAGGATTAACCTCGAGGTTAATCCTATTGCTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004902.2-597s21c1
Sequence:CCGGAGAAGTCGAGATCGAAGATTTCTCGAGAAATCTTCGATCTCGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004902
VALIDATED
RBM39 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 39
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-1851s1c1
Sequence:CCGGCCAACTTACCACAACCTGTTTCTCGAGAAACAGGTTGTGGTAAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004902.2-840s1c1
Sequence:CCGGCCAAGGGATTTGGAAGAGTTTCTCGAGAAACTCTTCCAAATCCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-1083s1c1
Sequence:CCGGGCTGGACCTATGAGGCTTTATCTCGAGATAAAGCCTCATAGGTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004902.2-1213s1c1
Sequence:CCGGCCAAGGGATATGGATTTATTACTCGAGTAATAAATCCATATCCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-547s1c1
Sequence:CCGGGCCGTGAAAGAAAGCGAAGTACTCGAGTACTTCGCTTTCTTTCACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004902.2-2389s21c1
Sequence:CCGGATCTTGCATTCTGATCAATTGCTCGAGCAATTGATCAGAATGCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004902.2-1338s21c1
Sequence:CCGGGCTTCGAGTGCTAGTTCATTTCTCGAGAAATGAACTAGCACTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004902.2-1135s21c1
Sequence:CCGGATATGCTTCGTGGGATCTTTGCTCGAGCAAAGATCCCACGAAGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004902.2-965s21c1
Sequence:CCGGGCCTCTAGCAATAGGATTAACCTCGAGGTTAATCCTATTGCTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004902.2-597s21c1
Sequence:CCGGAGAAGTCGAGATCGAAGATTTCTCGAGAAATCTTCGATCTCGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004902
VALIDATED
RBM39 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 39
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-1851s1c1
Sequence:CCGGCCAACTTACCACAACCTGTTTCTCGAGAAACAGGTTGTGGTAAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004902.2-840s1c1
Sequence:CCGGCCAAGGGATTTGGAAGAGTTTCTCGAGAAACTCTTCCAAATCCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-1083s1c1
Sequence:CCGGGCTGGACCTATGAGGCTTTATCTCGAGATAAAGCCTCATAGGTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004902.2-1213s1c1
Sequence:CCGGCCAAGGGATATGGATTTATTACTCGAGTAATAAATCCATATCCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004902.2-547s1c1
Sequence:CCGGGCCGTGAAAGAAAGCGAAGTACTCGAGTACTTCGCTTTCTTTCACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004902.2-2389s21c1
Sequence:CCGGATCTTGCATTCTGATCAATTGCTCGAGCAATTGATCAGAATGCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004902.2-1338s21c1
Sequence:CCGGGCTTCGAGTGCTAGTTCATTTCTCGAGAAATGAACTAGCACTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004902.2-1135s21c1
Sequence:CCGGATATGCTTCGTGGGATCTTTGCTCGAGCAAAGATCCCACGAAGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004902.2-965s21c1
Sequence:CCGGGCCTCTAGCAATAGGATTAACCTCGAGGTTAATCCTATTGCTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004902.2-597s21c1
Sequence:CCGGAGAAGTCGAGATCGAAGATTTCTCGAGAAATCTTCGATCTCGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133242
VALIDATED
RBM39 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 39
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133242.1-2786s1c1
Sequence:CCGGGCCAAATACATGAATGTGAATCTCGAGATTCACATTCATGTATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-762s1c1
Sequence:CCGGCCGAGAGATTTGGAAGAGTTTCTCGAGAAACTCTTCCAAATCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133242.1-1387s1c1
Sequence:CCGGCCGCACAACAAGCATTACAAACTCGAGTTTGTAATGCTTGTTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-1509s1c1
Sequence:CCGGGCTGCGTCTGTTCAACCTCTTCTCGAGAAGAGGTTGAACAGACGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-1292s1c1
Sequence:CCGGCGAACTAGAAAGGACTGGAATCTCGAGATTCCAGTCCTTTCTAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133242.2-2132s21c1
Sequence:CCGGTAACTAGCAAATCCTACTTTACTCGAGTAAAGTAGGATTTGCTAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1361s21c1
Sequence:CCGGGCTTCGAGTGCTAGTTCATTTCTCGAGAAATGAACTAGCACTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1610s21c1
Sequence:CCGGGCTGCGTCTGTTCAACCTCTTCTCGAGAAGAGGTTGAACAGACGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1125s21c1
Sequence:CCGGATGTAGGCTCATTACACTTTACTCGAGTAAAGTGTAATGAGCCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133242.2-705s21c1
Sequence:CCGGGATTGCCTCATAGCATCAAATCTCGAGATTTGATGCTATGAGGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133242
VALIDATED
RBM39 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 39
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133242.1-2786s1c1
Sequence:CCGGGCCAAATACATGAATGTGAATCTCGAGATTCACATTCATGTATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-762s1c1
Sequence:CCGGCCGAGAGATTTGGAAGAGTTTCTCGAGAAACTCTTCCAAATCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133242.1-1387s1c1
Sequence:CCGGCCGCACAACAAGCATTACAAACTCGAGTTTGTAATGCTTGTTGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-1509s1c1
Sequence:CCGGGCTGCGTCTGTTCAACCTCTTCTCGAGAAGAGGTTGAACAGACGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-1292s1c1
Sequence:CCGGCGAACTAGAAAGGACTGGAATCTCGAGATTCCAGTCCTTTCTAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133242.2-2132s21c1
Sequence:CCGGTAACTAGCAAATCCTACTTTACTCGAGTAAAGTAGGATTTGCTAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1361s21c1
Sequence:CCGGGCTTCGAGTGCTAGTTCATTTCTCGAGAAATGAACTAGCACTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1610s21c1
Sequence:CCGGGCTGCGTCTGTTCAACCTCTTCTCGAGAAGAGGTTGAACAGACGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1125s21c1
Sequence:CCGGATGTAGGCTCATTACACTTTACTCGAGTAAAGTGTAATGAGCCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133242.2-705s21c1
Sequence:CCGGGATTGCCTCATAGCATCAAATCTCGAGATTTGATGCTATGAGGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133242
VALIDATED
RBM39 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 39
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133242.1-2786s1c1
Sequence:CCGGGCCAAATACATGAATGTGAATCTCGAGATTCACATTCATGTATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-762s1c1
Sequence:CCGGCCGAGAGATTTGGAAGAGTTTCTCGAGAAACTCTTCCAAATCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133242.1-1387s1c1
Sequence:CCGGCCGCACAACAAGCATTACAAACTCGAGTTTGTAATGCTTGTTGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-1509s1c1
Sequence:CCGGGCTGCGTCTGTTCAACCTCTTCTCGAGAAGAGGTTGAACAGACGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133242.1-1292s1c1
Sequence:CCGGCGAACTAGAAAGGACTGGAATCTCGAGATTCCAGTCCTTTCTAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133242.2-2132s21c1
Sequence:CCGGTAACTAGCAAATCCTACTTTACTCGAGTAAAGTAGGATTTGCTAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1361s21c1
Sequence:CCGGGCTTCGAGTGCTAGTTCATTTCTCGAGAAATGAACTAGCACTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1610s21c1
Sequence:CCGGGCTGCGTCTGTTCAACCTCTTCTCGAGAAGAGGTTGAACAGACGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133242.2-1125s21c1
Sequence:CCGGATGTAGGCTCATTACACTTTACTCGAGTAAAGTGTAATGAGCCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133242.2-705s21c1
Sequence:CCGGGATTGCCTCATAGCATCAAATCTCGAGATTTGATGCTATGAGGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)