EMAIL THIS PAGE TO A FRIEND

RBM3

RNA binding motif (RNP1, RRM) protein 3

97 Gene Product Result for
Synonyms: IS1-RNPL RNPL
UniProtKB ID: P98179
Gene ID:
Human(5935) Summary: This gene is a member of the glycine-rich RNA-binding protein family and encodes a protein with one RNA recognition motif (RRM) domain. Expression of this gene is induced by cold shock and low oxygen tension. A pseudogene exists on chromosome 1. Multiple alternatively spliced transcript variants that are predicted to encode different isoforms have been characterized although some of these variants fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2008]
Mouse(19652) RNA binding motif protein 3
Rat(114488) RNA binding motif (RNP1, RRM) protein 3
dog(609457) RNA binding motif (RNP1, RRM) protein 3
domestic cat(101095080) RNA binding motif (RNP1, RRM) protein 3
cow(509771) RNA binding motif (RNP1, RRM) protein 3
sheep(101110819) RNA binding motif (RNP1, RRM) protein 3
domestic guinea pig(100730413) RNA binding motif (RNP1, RRM) protein 3
naked mole-rat(101702768) RNA binding motif (RNP1, RRM) protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006743 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017430 Rosetta Predictions human pricing
NM_001017431 Rosetta Predictions human pricing
NM_006743 Rosetta Predictions human pricing
NM_053696 Rosetta Predictions rat pricing
NM_016809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029558 predicted 844
2 SASI_Hs01_00029559 predicted 837
3 SASI_Hs01_00029560 predicted 835
4 SASI_Hs01_00029561 predicted 831
5 SASI_Hs01_00029562 predicted 835
6 SASI_Hs01_00029563 predicted 832
7 SASI_Hs01_00029564 predicted 840
8 SASI_Hs01_00029565 predicted 830
9 SASI_Hs01_00029566 predicted 846
10 SASI_Hs01_00029567 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096984 predicted 469
2 SASI_Hs01_00096985 predicted 461
3 SASI_Hs01_00096986 predicted 461
4 SASI_Hs01_00096987 predicted 459
5 SASI_Hs01_00096988 predicted 458
6 SASI_Hs01_00096989 predicted 453
7 SASI_Hs01_00096990 predicted 461
8 SASI_Hs01_00096991 predicted 458
9 SASI_Hs01_00096992 predicted 468
10 SASI_Hs01_00096993 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342194 predicted 483
2 SASI_Hs02_00342195 predicted 465
3 SASI_Hs02_00342196 predicted 470
4 SASI_Hs02_00342197 predicted 295
5 SASI_Hs02_00342198 predicted 533
6 SASI_Hs02_00342199 predicted 219
7 SASI_Hs02_00342200 predicted 517
8 SASI_Hs02_00342201 predicted 547
9 SASI_Hs02_00342202 predicted 493
10 SASI_Hs02_00342203 predicted 502
11 SASI_Hs01_00153095 predicted 568
12 SASI_Hs01_00153096 predicted 576
13 SASI_Hs01_00153097 predicted 572
14 SASI_Hs01_00153098 predicted 566
15 SASI_Hs01_00153099 predicted 565
16 SASI_Hs01_00153100 predicted 562
17 SASI_Hs01_00153101 predicted 577
18 SASI_Hs01_00153102 predicted 557
19 SASI_Hs01_00153103 predicted 570
20 SASI_Hs01_00153104 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266454 predicted 537
2 SASI_Rn02_00266455 predicted 629
3 SASI_Rn02_00266456 predicted 479
4 SASI_Rn02_00266457 predicted 526
5 SASI_Rn02_00266458 predicted 849
6 SASI_Rn02_00266459 predicted 275
7 SASI_Rn02_00266460 predicted 744
8 SASI_Rn02_00266461 predicted 711
9 SASI_Rn02_00266462 predicted 622
10 SASI_Rn02_00266463 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063988 predicted 501
2 SASI_Mm01_00063989 predicted 889
3 SASI_Mm01_00063990 predicted 577
4 SASI_Mm02_00323605 predicted 307
5 SASI_Mm01_00063991 predicted 876
6 SASI_Mm01_00063993 predicted 296
7 SASI_Mm01_00063994 predicted 942
8 SASI_Mm01_00063995 predicted 985
9 SASI_Mm01_00063996 predicted 948
10 SASI_Mm01_00063997 predicted 578
11 SASI_Mm01_00063992 predicted 902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016809
VALIDATED
RBM3 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif (RNP1, RRM) protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016809.4-940s21c1
Sequence:CCGGCTTTGCCTTGGTGCTAATTATCTCGAGATAATTAGCACCAAGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-498s21c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-137s21c1
Sequence:CCGGCACTTGAAGACCACTTCAGCACTCGAGTGCTGAAGTGGTCTTCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-426s1c1
Sequence:CCGGGTCGTCCTGGAGGATATGGATCTCGAGATCCATATCCTCCAGGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-138s1c1
Sequence:CCGGCACTTGAAGACCACTTCAGCACTCGAGTGCTGAAGTGGTCTTCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-167s1c1
Sequence:CCGGCCTATCTCTGAGGTGGTTGTTCTCGAGAACAACCACCTCAGAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016809.2-873s1c1
Sequence:CCGGGCCTCATATTTCTGTAACAATCTCGAGATTGTTACAGAAATATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-499s1c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-373s21c1
Sequence:CCGGAGTTACTCTAGAGGTGGTGGACTCGAGTCCACCACCTCTAGAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-425s21c1
Sequence:CCGGGTCGTCCTGGAGGATATGGATCTCGAGATCCATATCCTCCAGGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016809
VALIDATED
RBM3 MISSION shRNA shRNA Plasmid DNA
RNA binding motif (RNP1, RRM) protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016809.4-940s21c1
Sequence:CCGGCTTTGCCTTGGTGCTAATTATCTCGAGATAATTAGCACCAAGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-498s21c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-137s21c1
Sequence:CCGGCACTTGAAGACCACTTCAGCACTCGAGTGCTGAAGTGGTCTTCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-426s1c1
Sequence:CCGGGTCGTCCTGGAGGATATGGATCTCGAGATCCATATCCTCCAGGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-138s1c1
Sequence:CCGGCACTTGAAGACCACTTCAGCACTCGAGTGCTGAAGTGGTCTTCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-167s1c1
Sequence:CCGGCCTATCTCTGAGGTGGTTGTTCTCGAGAACAACCACCTCAGAGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016809.2-873s1c1
Sequence:CCGGGCCTCATATTTCTGTAACAATCTCGAGATTGTTACAGAAATATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-499s1c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-373s21c1
Sequence:CCGGAGTTACTCTAGAGGTGGTGGACTCGAGTCCACCACCTCTAGAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-425s21c1
Sequence:CCGGGTCGTCCTGGAGGATATGGATCTCGAGATCCATATCCTCCAGGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016809
VALIDATED
RBM3 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif (RNP1, RRM) protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295193    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016809.4-940s21c1
Sequence:CCGGCTTTGCCTTGGTGCTAATTATCTCGAGATAATTAGCACCAAGGCAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-498s21c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-137s21c1
Sequence:CCGGCACTTGAAGACCACTTCAGCACTCGAGTGCTGAAGTGGTCTTCAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-426s1c1
Sequence:CCGGGTCGTCCTGGAGGATATGGATCTCGAGATCCATATCCTCCAGGACGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-138s1c1
Sequence:CCGGCACTTGAAGACCACTTCAGCACTCGAGTGCTGAAGTGGTCTTCAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-167s1c1
Sequence:CCGGCCTATCTCTGAGGTGGTTGTTCTCGAGAACAACCACCTCAGAGATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016809.2-873s1c1
Sequence:CCGGGCCTCATATTTCTGTAACAATCTCGAGATTGTTACAGAAATATGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016809.2-499s1c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-373s21c1
Sequence:CCGGAGTTACTCTAGAGGTGGTGGACTCGAGTCCACCACCTCTAGAGTAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016809.4-425s21c1
Sequence:CCGGGTCGTCCTGGAGGATATGGATCTCGAGATCCATATCCTCCAGGACGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006743
VALIDATED
RBM3 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif (RNP1, RRM) protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-1024s21c1
Sequence:CCGGCCCAATGTACCTATAAGAAATCTCGAGATTTCTTATAGGTACATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-300s21c1
Sequence:CCGGTCACCAACCCAGAGCATGCTTCTCGAGAAGCATGCTCTGGGTTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-528s21c1
Sequence:CCGGGACGTTCCAGAGACTATAATGCTCGAGCATTATAGTCTCTGGAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-612s21c1
Sequence:CCGGGAAATGAGACATGCACATAATCTCGAGATTATGTGCATGTCTCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-948s1c1
Sequence:CCGGCCCAATGTACCTATAAGAAATCTCGAGATTTCTTATAGGTACATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-403s1c1
Sequence:CCGGAGTGGCAGGTATTATGACAGTCTCGAGACTGTCATAATACCTGCCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-224s1c1
Sequence:CCGGTCACCAACCCAGAGCATGCTTCTCGAGAAGCATGCTCTGGGTTGGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006743.x-407s1c1
Sequence:CCGGGCAGGTATTATGACAGTCGACCTCGAGGTCGACTGTCATAATACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-282s1c1
Sequence:CCGGTGGTCGTCAGATCCGTGTGGACTCGAGTCCACACGGATCTGACGACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-571s21c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006743
VALIDATED
RBM3 MISSION shRNA shRNA Plasmid DNA
RNA binding motif (RNP1, RRM) protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-1024s21c1
Sequence:CCGGCCCAATGTACCTATAAGAAATCTCGAGATTTCTTATAGGTACATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-300s21c1
Sequence:CCGGTCACCAACCCAGAGCATGCTTCTCGAGAAGCATGCTCTGGGTTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-528s21c1
Sequence:CCGGGACGTTCCAGAGACTATAATGCTCGAGCATTATAGTCTCTGGAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-612s21c1
Sequence:CCGGGAAATGAGACATGCACATAATCTCGAGATTATGTGCATGTCTCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-948s1c1
Sequence:CCGGCCCAATGTACCTATAAGAAATCTCGAGATTTCTTATAGGTACATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-403s1c1
Sequence:CCGGAGTGGCAGGTATTATGACAGTCTCGAGACTGTCATAATACCTGCCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-224s1c1
Sequence:CCGGTCACCAACCCAGAGCATGCTTCTCGAGAAGCATGCTCTGGGTTGGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006743.x-407s1c1
Sequence:CCGGGCAGGTATTATGACAGTCGACCTCGAGGTCGACTGTCATAATACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-282s1c1
Sequence:CCGGTGGTCGTCAGATCCGTGTGGACTCGAGTCCACACGGATCTGACGACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-571s21c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006743
VALIDATED
RBM3 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif (RNP1, RRM) protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-1024s21c1
Sequence:CCGGCCCAATGTACCTATAAGAAATCTCGAGATTTCTTATAGGTACATTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-300s21c1
Sequence:CCGGTCACCAACCCAGAGCATGCTTCTCGAGAAGCATGCTCTGGGTTGGTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-528s21c1
Sequence:CCGGGACGTTCCAGAGACTATAATGCTCGAGCATTATAGTCTCTGGAACGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-612s21c1
Sequence:CCGGGAAATGAGACATGCACATAATCTCGAGATTATGTGCATGTCTCATTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001248    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-948s1c1
Sequence:CCGGCCCAATGTACCTATAAGAAATCTCGAGATTTCTTATAGGTACATTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-403s1c1
Sequence:CCGGAGTGGCAGGTATTATGACAGTCTCGAGACTGTCATAATACCTGCCACTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-224s1c1
Sequence:CCGGTCACCAACCCAGAGCATGCTTCTCGAGAAGCATGCTCTGGGTTGGTGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006743.x-407s1c1
Sequence:CCGGGCAGGTATTATGACAGTCGACCTCGAGGTCGACTGTCATAATACCTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006743.x-282s1c1
Sequence:CCGGTGGTCGTCAGATCCGTGTGGACTCGAGTCCACACGGATCTGACGACCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000273461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006743.3-571s21c1
Sequence:CCGGCCGCTACTCAGGAGGAAATTACTCGAGTAATTTCCTCCTGAGTAGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???