EMAIL THIS PAGE TO A FRIEND

RBM41

RNA binding motif protein 41

92 Gene Product Result for
UniProtKB ID: Q96IZ5, Q5JSN7, Q5JSN8, Q9H8F7, Q9NV04
Gene ID:
Mouse(237073) RNA binding motif protein 41
Rat(680581) RNA binding motif protein 41
Zebrafish(492764) RNA binding motif protein 41
dog(492053) RNA binding motif protein 41
domestic cat(101085028) RNA binding motif protein 41
Horse(100060588) RNA binding motif protein 41
chicken(428698) RNA binding motif protein 41
domestic guinea pig(100720140) RNA binding motif protein 41
naked mole-rat(101696576) RNA binding motif protein 41
cow(536054) RNA binding motif protein 41
sheep(101116022) RNA binding motif protein 41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018301 Rosetta Predictions human pricing
NM_001109420 Rosetta Predictions rat pricing
NM_153586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218259 predicted 303
2 SASI_Hs01_00218260 predicted 1255
3 SASI_Hs01_00218261 predicted 281
4 SASI_Hs01_00218262 predicted 1040
5 SASI_Hs01_00218263 predicted 225
6 SASI_Hs02_00351710 predicted 438
7 SASI_Hs01_00218265 predicted 220
8 SASI_Hs01_00218266 predicted 1038
9 SASI_Hs01_00218267 predicted 1138
10 SASI_Hs01_00218268 predicted 843
11 SASI_Hs01_00218264 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248237 predicted 1018
2 SASI_Rn02_00248238 predicted 537
3 SASI_Rn02_00248239 predicted 989
4 SASI_Rn02_00248240 predicted 865
5 SASI_Rn02_00248241 predicted 916
6 SASI_Rn02_00248242 predicted 996
7 SASI_Rn02_00248243 predicted 876
8 SASI_Rn02_00248244 predicted 1016
9 SASI_Rn02_00248245 predicted 932
10 SASI_Rn02_00248246 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343404 predicted 1150
2 SASI_Mm02_00343405 predicted 305
3 SASI_Mm02_00343406 predicted 984
4 SASI_Mm02_00343407 predicted 997
5 SASI_Mm02_00343408 predicted 532
6 SASI_Mm02_00343409 predicted 1162
7 SASI_Mm02_00343410 predicted 324
8 SASI_Mm02_00343411 predicted 286
9 SASI_Mm02_00343412 predicted 867
10 SASI_Mm02_00343413 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018301
RBM41 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 41
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018301.3-1146s21c1
Sequence:CCGGGCAAGCATTGCATCTAGTAAACTCGAGTTTACTAGATGCAATGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018301.3-1698s21c1
Sequence:CCGGAGAGCCCATTTGCCATATTTCCTCGAGGAAATATGGCAAATGGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1477s1c1
Sequence:CCGGGCTGAGTATGAAGGGTAAAGTCTCGAGACTTTACCCTTCATACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-895s1c1
Sequence:CCGGGTCAGAGGAAGAGATCCGAAACTCGAGTTTCGGATCTCTTCCTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-1238s1c1
Sequence:CCGGGCTACAGGTAGCACTACAGAACTCGAGTTCTGTAGTGCTACCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-147s1c1
Sequence:CCGGCCATTGAGGAATGTATGTCTACTCGAGTAGACATACATTCCTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1465s1c1
Sequence:CCGGGACAGATGATATGCTGAGTATCTCGAGATACTCAGCATATCATCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-1088s1c1
Sequence:CCGGGCCTTTATCACCTTTCCCAATCTCGAGATTGGGAAAGGTGATAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018301.3-968s21c1
Sequence:CCGGGGGAACCAAACAAGGTATTATCTCGAGATAATACCTTGTTTGGTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1529s1c1
Sequence:CCGGCAACGGATTATTCCTAAGGATCTCGAGATCCTTAGGAATAATCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018301
RBM41 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 41
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018301.3-1146s21c1
Sequence:CCGGGCAAGCATTGCATCTAGTAAACTCGAGTTTACTAGATGCAATGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018301.3-1698s21c1
Sequence:CCGGAGAGCCCATTTGCCATATTTCCTCGAGGAAATATGGCAAATGGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1477s1c1
Sequence:CCGGGCTGAGTATGAAGGGTAAAGTCTCGAGACTTTACCCTTCATACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-895s1c1
Sequence:CCGGGTCAGAGGAAGAGATCCGAAACTCGAGTTTCGGATCTCTTCCTCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-1238s1c1
Sequence:CCGGGCTACAGGTAGCACTACAGAACTCGAGTTCTGTAGTGCTACCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-147s1c1
Sequence:CCGGCCATTGAGGAATGTATGTCTACTCGAGTAGACATACATTCCTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1465s1c1
Sequence:CCGGGACAGATGATATGCTGAGTATCTCGAGATACTCAGCATATCATCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-1088s1c1
Sequence:CCGGGCCTTTATCACCTTTCCCAATCTCGAGATTGGGAAAGGTGATAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018301.3-968s21c1
Sequence:CCGGGGGAACCAAACAAGGTATTATCTCGAGATAATACCTTGTTTGGTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1529s1c1
Sequence:CCGGCAACGGATTATTCCTAAGGATCTCGAGATCCTTAGGAATAATCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018301
RBM41 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 41
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018301.3-1146s21c1
Sequence:CCGGGCAAGCATTGCATCTAGTAAACTCGAGTTTACTAGATGCAATGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018301.3-1698s21c1
Sequence:CCGGAGAGCCCATTTGCCATATTTCCTCGAGGAAATATGGCAAATGGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137155    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1477s1c1
Sequence:CCGGGCTGAGTATGAAGGGTAAAGTCTCGAGACTTTACCCTTCATACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-895s1c1
Sequence:CCGGGTCAGAGGAAGAGATCCGAAACTCGAGTTTCGGATCTCTTCCTCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-1238s1c1
Sequence:CCGGGCTACAGGTAGCACTACAGAACTCGAGTTCTGTAGTGCTACCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-147s1c1
Sequence:CCGGCCATTGAGGAATGTATGTCTACTCGAGTAGACATACATTCCTCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1465s1c1
Sequence:CCGGGACAGATGATATGCTGAGTATCTCGAGATACTCAGCATATCATCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018301.2-1088s1c1
Sequence:CCGGGCCTTTATCACCTTTCCCAATCTCGAGATTGGGAAAGGTGATAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018301.3-968s21c1
Sequence:CCGGGGGAACCAAACAAGGTATTATCTCGAGATAATACCTTGTTTGGTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018301.2-1529s1c1
Sequence:CCGGCAACGGATTATTCCTAAGGATCTCGAGATCCTTAGGAATAATCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153586
VALIDATED
RBM41 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 41
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153586.1-971s21c1
Sequence:CCGGGAACCAAACAAGGTGCTATATCTCGAGATATAGCACCTTGTTTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-656s1c1
Sequence:CCGGCGTCTTGAAGAGTTCCAACTTCTCGAGAAGTTGGAACTCTTCAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-1019s1c1
Sequence:CCGGGAAAGAGACCTTATCTCATTACTCGAGTAATGAGATAAGGTCTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-999s21c1
Sequence:CCGGACCTTAGTCCTCGGGTGAAAGCTCGAGCTTTCACCCGAGGACTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-2284s21c1
Sequence:CCGGTTCCCTAGTGATTCGTTTATACTCGAGTATAAACGAATCACTAGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-875s1c1
Sequence:CCGGCCAATAGAATTTATCCCAGAACTCGAGTTCTGGGATAAATTCTATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-409s21c1
Sequence:CCGGGAAACGGCTTGAAGATATTAACTCGAGTTAATATCTTCAAGCCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-401s1c1
Sequence:CCGGGCAATACAGAAACGGCTTGAACTCGAGTTCAAGCCGTTTCTGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153586.1-1237s21c1
Sequence:CCGGTCAGCGCTCTTCCCTTATAACCTCGAGGTTATAAGGGAAGAGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153586
VALIDATED
RBM41 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 41
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153586.1-971s21c1
Sequence:CCGGGAACCAAACAAGGTGCTATATCTCGAGATATAGCACCTTGTTTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-656s1c1
Sequence:CCGGCGTCTTGAAGAGTTCCAACTTCTCGAGAAGTTGGAACTCTTCAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-1019s1c1
Sequence:CCGGGAAAGAGACCTTATCTCATTACTCGAGTAATGAGATAAGGTCTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-999s21c1
Sequence:CCGGACCTTAGTCCTCGGGTGAAAGCTCGAGCTTTCACCCGAGGACTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-2284s21c1
Sequence:CCGGTTCCCTAGTGATTCGTTTATACTCGAGTATAAACGAATCACTAGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-875s1c1
Sequence:CCGGCCAATAGAATTTATCCCAGAACTCGAGTTCTGGGATAAATTCTATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-409s21c1
Sequence:CCGGGAAACGGCTTGAAGATATTAACTCGAGTTAATATCTTCAAGCCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-401s1c1
Sequence:CCGGGCAATACAGAAACGGCTTGAACTCGAGTTCAAGCCGTTTCTGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153586.1-1237s21c1
Sequence:CCGGTCAGCGCTCTTCCCTTATAACCTCGAGGTTATAAGGGAAGAGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153586
VALIDATED
RBM41 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 41
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153586.1-971s21c1
Sequence:CCGGGAACCAAACAAGGTGCTATATCTCGAGATATAGCACCTTGTTTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-656s1c1
Sequence:CCGGCGTCTTGAAGAGTTCCAACTTCTCGAGAAGTTGGAACTCTTCAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-1019s1c1
Sequence:CCGGGAAAGAGACCTTATCTCATTACTCGAGTAATGAGATAAGGTCTCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-999s21c1
Sequence:CCGGACCTTAGTCCTCGGGTGAAAGCTCGAGCTTTCACCCGAGGACTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-2284s21c1
Sequence:CCGGTTCCCTAGTGATTCGTTTATACTCGAGTATAAACGAATCACTAGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-875s1c1
Sequence:CCGGCCAATAGAATTTATCCCAGAACTCGAGTTCTGGGATAAATTCTATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153586.1-409s21c1
Sequence:CCGGGAAACGGCTTGAAGATATTAACTCGAGTTAATATCTTCAAGCCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153586.1-401s1c1
Sequence:CCGGGCAATACAGAAACGGCTTGAACTCGAGTTCAAGCCGTTTCTGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153586.1-1237s21c1
Sequence:CCGGTCAGCGCTCTTCCCTTATAACCTCGAGGTTATAAGGGAAGAGCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)