EMAIL THIS PAGE TO A FRIEND

RBM44

RNA binding motif protein 44

113 Gene Product Result for
UniProtKB ID: Q6ZP01, A0AUW3
Gene ID:
Mouse(329207) RNA binding motif protein 44
Rat(501183) RNA binding motif protein 44
dog(100686260) RNA binding motif protein 44
domestic cat(101091889) RNA binding motif protein 44
Horse(100066523) RNA binding motif protein 44
cow(789298) RNA binding motif protein 44
sheep(101123420) RNA binding motif protein 44
naked mole-rat(101719487) RNA binding motif protein 44
Domestic Rabbit(100345915) RNA binding motif protein 44
domestic guinea pig(100715251) RNA binding motif protein 44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198852 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080504 Rosetta Predictions human pricing
XM_496622 Rosetta Predictions human pricing
XM_001066845 Rosetta Predictions rat pricing
XM_576610 Rosetta Predictions rat pricing
NM_001033408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315477 predicted 976
2 SASI_Hs02_00315478 predicted 1572
3 SASI_Hs02_00315479 predicted 3043
4 SASI_Hs02_00315480 predicted 2781
5 SASI_Hs02_00315481 predicted 3015
6 SASI_Hs02_00315482 predicted 1244
7 SASI_Hs02_00315483 predicted 3035
8 SASI_Hs02_00315484 predicted 2425
9 SASI_Hs02_00315485 predicted 798
10 SASI_Hs02_00315486 predicted 1708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279931 predicted 670
2 SASI_Hs01_00279932 predicted 392
3 SASI_Hs01_00279933 predicted 241
4 SASI_Hs01_00279934 predicted 605
5 SASI_Hs01_00279935 predicted 504
6 SASI_Hs01_00279936 predicted 844
7 SASI_Hs01_00279937 predicted 522
8 SASI_Hs01_00279938 predicted 814
9 SASI_Hs01_00279939 predicted 828
10 SASI_Hs01_00279940 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318862 predicted 2798
2 SASI_Rn02_00318863 predicted 404
3 SASI_Rn02_00318864 predicted 2420
4 SASI_Rn02_00318865 predicted 2196
5 SASI_Rn02_00318866 predicted 2045
6 SASI_Rn02_00318867 predicted 2819
7 SASI_Rn02_00318868 predicted 2324
8 SASI_Rn02_00318869 predicted 1534
9 SASI_Rn02_00318870 predicted 2405
10 SASI_Rn02_00318871 predicted 1760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405623 predicted 2799
2 SASI_Rn02_00405624 predicted 403
3 SASI_Rn02_00405625 predicted 2418
4 SASI_Rn02_00405626 predicted 2195
5 SASI_Rn02_00405627 predicted 2042
6 SASI_Rn02_00405628 predicted 2814
7 SASI_Rn02_00405629 predicted 2317
8 SASI_Rn02_00405630 predicted 1539
9 SASI_Rn02_00405631 predicted 2403
10 SASI_Rn02_00405632 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107952 predicted 641
2 SASI_Mm01_00107953 predicted 295
3 SASI_Mm01_00107954 predicted 1609
4 SASI_Mm01_00107955 predicted 2540
5 SASI_Mm01_00107956 predicted 685
6 SASI_Mm01_00107957 predicted 2501
7 SASI_Mm01_00107958 predicted 2928
8 SASI_Mm02_00288706 predicted 3169
9 SASI_Mm01_00107960 predicted 669
10 SASI_Mm01_00107961 predicted 1410
11 SASI_Mm01_00107959 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033408
RBM44 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-201s21c1
Sequence:CCGGATGGTTGCAACGGAGTTATTTCTCGAGAAATAACTCCGTTGCAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033408.4-3233s21c1
Sequence:CCGGGTAATTGGACCTAACCCTTTACTCGAGTAAAGGGTTAGGTCCAATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-411s21c1
Sequence:CCGGAGACCTATTCTATCCATTATTCTCGAGAATAATGGATAGAATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-1765s21c1
Sequence:CCGGGACCACTGAGAGGGCTATAAACTCGAGTTTATAGCCCTCTCAGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-2994s21c1
Sequence:CCGGACATCAGCAGAGATCACATTACTCGAGTAATGTGATCTCTGCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033408
RBM44 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-201s21c1
Sequence:CCGGATGGTTGCAACGGAGTTATTTCTCGAGAAATAACTCCGTTGCAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033408.4-3233s21c1
Sequence:CCGGGTAATTGGACCTAACCCTTTACTCGAGTAAAGGGTTAGGTCCAATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-411s21c1
Sequence:CCGGAGACCTATTCTATCCATTATTCTCGAGAATAATGGATAGAATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-1765s21c1
Sequence:CCGGGACCACTGAGAGGGCTATAAACTCGAGTTTATAGCCCTCTCAGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-2994s21c1
Sequence:CCGGACATCAGCAGAGATCACATTACTCGAGTAATGTGATCTCTGCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033408
RBM44 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-201s21c1
Sequence:CCGGATGGTTGCAACGGAGTTATTTCTCGAGAAATAACTCCGTTGCAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033408.4-3233s21c1
Sequence:CCGGGTAATTGGACCTAACCCTTTACTCGAGTAAAGGGTTAGGTCCAATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-411s21c1
Sequence:CCGGAGACCTATTCTATCCATTATTCTCGAGAATAATGGATAGAATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-1765s21c1
Sequence:CCGGGACCACTGAGAGGGCTATAAACTCGAGTTTATAGCCCTCTCAGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033408.4-2994s21c1
Sequence:CCGGACATCAGCAGAGATCACATTACTCGAGTAATGTGATCTCTGCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198852
RBM44 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 44
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-629s1c1
Sequence:CCGGCAGGAAGTGAGAATAAGACATCTCGAGATGTCTTATTCTCACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-565s1c1
Sequence:CCGGGATCATAAAGAGACTGGCTGACTCGAGTCAGCCAGTCTCTTTATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-206s1c1
Sequence:CCGGGATGCAAAGATAGCTGTGAAACTCGAGTTTCACAGCTATCTTTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-530s1c1
Sequence:CCGGCCTCCAAATACATTGAACCTTCTCGAGAAGGTTCAATGTATTTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-547s1c1
Sequence:CCGGCCTTCGTAGCTTTACCAAGATCTCGAGATCTTGGTAAAGCTACGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-540s1c1
Sequence:CCGGCATTGAACCTTCGTAGCTTTACTCGAGTAAAGCTACGAAGGTTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-106s1c1
Sequence:CCGGCGATTTAAGGTCTCATTTCCACTCGAGTGGAAATGAGACCTTAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-172s1c1
Sequence:CCGGCAGATATGCATCTCTTGCTTTCTCGAGAAAGCAAGAGATGCATATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-517s1c1
Sequence:CCGGCGTTCAATTCATACCTCCAAACTCGAGTTTGGAGGTATGAATTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-384s1c1
Sequence:CCGGCCATTTCTAGATTGCCCAGAACTCGAGTTCTGGGCAATCTAGAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198852
RBM44 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 44
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-629s1c1
Sequence:CCGGCAGGAAGTGAGAATAAGACATCTCGAGATGTCTTATTCTCACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-565s1c1
Sequence:CCGGGATCATAAAGAGACTGGCTGACTCGAGTCAGCCAGTCTCTTTATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-206s1c1
Sequence:CCGGGATGCAAAGATAGCTGTGAAACTCGAGTTTCACAGCTATCTTTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-530s1c1
Sequence:CCGGCCTCCAAATACATTGAACCTTCTCGAGAAGGTTCAATGTATTTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-547s1c1
Sequence:CCGGCCTTCGTAGCTTTACCAAGATCTCGAGATCTTGGTAAAGCTACGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-540s1c1
Sequence:CCGGCATTGAACCTTCGTAGCTTTACTCGAGTAAAGCTACGAAGGTTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-106s1c1
Sequence:CCGGCGATTTAAGGTCTCATTTCCACTCGAGTGGAAATGAGACCTTAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-172s1c1
Sequence:CCGGCAGATATGCATCTCTTGCTTTCTCGAGAAAGCAAGAGATGCATATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-517s1c1
Sequence:CCGGCGTTCAATTCATACCTCCAAACTCGAGTTTGGAGGTATGAATTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-384s1c1
Sequence:CCGGCCATTTCTAGATTGCCCAGAACTCGAGTTCTGGGCAATCTAGAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198852
RBM44 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 44
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-629s1c1
Sequence:CCGGCAGGAAGTGAGAATAAGACATCTCGAGATGTCTTATTCTCACTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-565s1c1
Sequence:CCGGGATCATAAAGAGACTGGCTGACTCGAGTCAGCCAGTCTCTTTATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-206s1c1
Sequence:CCGGGATGCAAAGATAGCTGTGAAACTCGAGTTTCACAGCTATCTTTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-530s1c1
Sequence:CCGGCCTCCAAATACATTGAACCTTCTCGAGAAGGTTCAATGTATTTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-547s1c1
Sequence:CCGGCCTTCGTAGCTTTACCAAGATCTCGAGATCTTGGTAAAGCTACGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-540s1c1
Sequence:CCGGCATTGAACCTTCGTAGCTTTACTCGAGTAAAGCTACGAAGGTTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-106s1c1
Sequence:CCGGCGATTTAAGGTCTCATTTCCACTCGAGTGGAAATGAGACCTTAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198852.1-172s1c1
Sequence:CCGGCAGATATGCATCTCTTGCTTTCTCGAGAAAGCAAGAGATGCATATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-517s1c1
Sequence:CCGGCGTTCAATTCATACCTCCAAACTCGAGTTTGGAGGTATGAATTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198852.1-384s1c1
Sequence:CCGGCCATTTCTAGATTGCCCAGAACTCGAGTTCTGGGCAATCTAGAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)