EMAIL THIS PAGE TO A FRIEND

RBM45

RNA binding motif protein 45

49 Gene Product Result for
Synonyms: DRB1
UniProtKB ID: Q8IUH3, Q6NYL0, Q8NFC9
Gene ID:
Mouse(241490) RNA binding motif protein 45
Rat(266631) RNA binding motif protein 45
domestic guinea pig(100729587) RNA binding motif protein 45
Domestic Rabbit(100353919) RNA binding motif protein 45
naked mole-rat(101717533) RNA binding motif protein 45
cow(535331) RNA binding motif protein 45
sheep(101103294) RNA binding motif protein 45
Zebrafish(568524) RNA binding motif protein 45
chicken(424132) RNA binding motif protein 45
domestic cat(101100498) RNA binding motif protein 45
Horse(100067142) RNA binding motif protein 45
dog(478815) RNA binding motif protein 45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41153 Anti-DRB1 antibody produced in rabbit IgG fraction of antiserum guinea pig, dog, rabbit, rat, human, mouse
western blot pricing
SAB2108539 Anti-RBM45 affinity isolated antibody rat, human, guinea pig
western blot pricing
AV41154 Anti-RBM45 antibody produced in rabbit affinity isolated antibody rat, bovine, mouse, human, rat, guinea pig, human, rabbit, horse
western blot pricing
HPA020448 Anti-RBM45 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152945 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152945 Rosetta Predictions human pricing
NM_153306 Rosetta Predictions rat pricing
NM_153405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147653 predicted 642
2 SASI_Hs01_00147654 predicted 685
3 SASI_Hs01_00147655 predicted 814
4 SASI_Hs01_00147656 predicted 759
5 SASI_Hs01_00147657 predicted 509
6 SASI_Hs01_00147658 predicted 717
7 SASI_Hs01_00147659 predicted 523
8 SASI_Hs01_00147660 predicted 822
9 SASI_Hs02_00366932 predicted 445
10 SASI_Hs02_00366933 predicted 687
11 SASI_Hs01_00147652 predicted 906
12 SASI_Hs01_00147661 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098658 predicted 494
2 SASI_Rn02_00268951 predicted 1330
3 SASI_Rn01_00098659 predicted 1216
4 SASI_Rn01_00098660 predicted 941
5 SASI_Rn01_00098661 predicted 601
6 SASI_Rn01_00098662 predicted 486
7 SASI_Rn01_00098664 predicted 1272
8 SASI_Rn01_00098665 predicted 1018
9 SASI_Rn01_00098666 predicted 869
10 SASI_Rn02_00268952 predicted 1154
11 SASI_Rn01_00098663 predicted 1266
12 SASI_Rn01_00098667 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165704 predicted 1128
2 SASI_Mm01_00165705 predicted 1426
3 SASI_Mm01_00165707 predicted 1261
4 SASI_Mm01_00165708 predicted 578
5 SASI_Mm01_00165709 predicted 505
6 SASI_Mm01_00165710 predicted 472
7 SASI_Mm01_00165711 predicted 1368
8 SASI_Mm02_00343190 predicted 559
9 SASI_Mm01_00165712 predicted 510
10 SASI_Mm01_00165713 predicted 573
11 SASI_Mm01_00165706 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152945
RBM45 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 45
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-968s21c1
Sequence:CCGGTAATGTAGCATCAGCTATTTACTCGAGTAAATAGCTGATGCTACATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-1331s21c1
Sequence:CCGGTGGTAACCTGATCGAAGTTTACTCGAGTAAACTTCGATCAGGTTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-1076s1c1
Sequence:CCGGCCTTCATTGATGATGGAAGTACTCGAGTACTTCCATCATCAATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-946s1c1
Sequence:CCGGGAAGTTCAACGAGATCCTTATCTCGAGATAAGGATCTCGTTGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-505s1c1
Sequence:CCGGCCAAAGTCCTACACAGAAGAACTCGAGTTCTTCTGTGTAGGACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152945.1-1596s1c1
Sequence:CCGGGCCGATAGAATAAGTGCTAATCTCGAGATTAGCACTTATTCTATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-928s1c1
Sequence:CCGGCCAGGATTGGAATATTGTGAACTCGAGTTCACAATATTCCAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-580s21c1
Sequence:CCGGTGGGCTACGTACGATACTTAACTCGAGTTAAGTATCGTACGTAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152945
RBM45 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 45
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-968s21c1
Sequence:CCGGTAATGTAGCATCAGCTATTTACTCGAGTAAATAGCTGATGCTACATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-1331s21c1
Sequence:CCGGTGGTAACCTGATCGAAGTTTACTCGAGTAAACTTCGATCAGGTTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-1076s1c1
Sequence:CCGGCCTTCATTGATGATGGAAGTACTCGAGTACTTCCATCATCAATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-946s1c1
Sequence:CCGGGAAGTTCAACGAGATCCTTATCTCGAGATAAGGATCTCGTTGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-505s1c1
Sequence:CCGGCCAAAGTCCTACACAGAAGAACTCGAGTTCTTCTGTGTAGGACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152945.1-1596s1c1
Sequence:CCGGGCCGATAGAATAAGTGCTAATCTCGAGATTAGCACTTATTCTATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-928s1c1
Sequence:CCGGCCAGGATTGGAATATTGTGAACTCGAGTTCACAATATTCCAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-580s21c1
Sequence:CCGGTGGGCTACGTACGATACTTAACTCGAGTTAAGTATCGTACGTAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152945
RBM45 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 45
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-968s21c1
Sequence:CCGGTAATGTAGCATCAGCTATTTACTCGAGTAAATAGCTGATGCTACATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-1331s21c1
Sequence:CCGGTGGTAACCTGATCGAAGTTTACTCGAGTAAACTTCGATCAGGTTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-1076s1c1
Sequence:CCGGCCTTCATTGATGATGGAAGTACTCGAGTACTTCCATCATCAATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-946s1c1
Sequence:CCGGGAAGTTCAACGAGATCCTTATCTCGAGATAAGGATCTCGTTGAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-505s1c1
Sequence:CCGGCCAAAGTCCTACACAGAAGAACTCGAGTTCTTCTGTGTAGGACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118592    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152945.1-1596s1c1
Sequence:CCGGGCCGATAGAATAAGTGCTAATCTCGAGATTAGCACTTATTCTATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152945.1-928s1c1
Sequence:CCGGCCAGGATTGGAATATTGTGAACTCGAGTTCACAATATTCCAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152945.2-580s21c1
Sequence:CCGGTGGGCTACGTACGATACTTAACTCGAGTTAAGTATCGTACGTAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153405
VALIDATED
RBM45 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 45
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153405.1-499s1c2
Sequence:CCGGCGAGTATTGCAGCATTATTAACTCGAGTTAATAATGCTGCAATACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-571s21c1
Sequence:CCGGGTATGGAGATATCGAGTATTGCTCGAGCAATACTCGATATCTCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153405.2-632s21c1
Sequence:CCGGTTGGGCTACGTGCGCTATTTACTCGAGTAAATAGCGCACGTAGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153405.2-1108s21c1
Sequence:CCGGCCTGGATGACGGGAGTAATATCTCGAGATATTACTCCCGTCATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153405.2-1718s1c1
Sequence:CCGGGTCTTCACACCATTGCTTATCCTCGAGGATAAGCAATGGTGTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153405.1-712s1c1
Sequence:CCGGCAGAGCAAATCTGTTTCCCTTCTCGAGAAGGGAAACAGATTTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-1717s21c1
Sequence:CCGGAGTCTTCACACCATTGCTTATCTCGAGATAAGCAATGGTGTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-1027s21c1
Sequence:CCGGTAACGTAGCATCAGCTATTTACTCGAGTAAATAGCTGATGCTACGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153405
VALIDATED
RBM45 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 45
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153405.1-499s1c2
Sequence:CCGGCGAGTATTGCAGCATTATTAACTCGAGTTAATAATGCTGCAATACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-571s21c1
Sequence:CCGGGTATGGAGATATCGAGTATTGCTCGAGCAATACTCGATATCTCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153405.2-632s21c1
Sequence:CCGGTTGGGCTACGTGCGCTATTTACTCGAGTAAATAGCGCACGTAGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153405.2-1108s21c1
Sequence:CCGGCCTGGATGACGGGAGTAATATCTCGAGATATTACTCCCGTCATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153405.2-1718s1c1
Sequence:CCGGGTCTTCACACCATTGCTTATCCTCGAGGATAAGCAATGGTGTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153405.1-712s1c1
Sequence:CCGGCAGAGCAAATCTGTTTCCCTTCTCGAGAAGGGAAACAGATTTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-1717s21c1
Sequence:CCGGAGTCTTCACACCATTGCTTATCTCGAGATAAGCAATGGTGTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-1027s21c1
Sequence:CCGGTAACGTAGCATCAGCTATTTACTCGAGTAAATAGCTGATGCTACGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153405
VALIDATED
RBM45 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 45
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153405.1-499s1c2
Sequence:CCGGCGAGTATTGCAGCATTATTAACTCGAGTTAATAATGCTGCAATACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-571s21c1
Sequence:CCGGGTATGGAGATATCGAGTATTGCTCGAGCAATACTCGATATCTCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153405.2-632s21c1
Sequence:CCGGTTGGGCTACGTGCGCTATTTACTCGAGTAAATAGCGCACGTAGCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153405.2-1108s21c1
Sequence:CCGGCCTGGATGACGGGAGTAATATCTCGAGATATTACTCCCGTCATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153405.2-1718s1c1
Sequence:CCGGGTCTTCACACCATTGCTTATCCTCGAGGATAAGCAATGGTGTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153405.1-712s1c1
Sequence:CCGGCAGAGCAAATCTGTTTCCCTTCTCGAGAAGGGAAACAGATTTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-1717s21c1
Sequence:CCGGAGTCTTCACACCATTGCTTATCTCGAGATAAGCAATGGTGTGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153405.2-1027s21c1
Sequence:CCGGTAACGTAGCATCAGCTATTTACTCGAGTAAATAGCTGATGCTACGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)