EMAIL THIS PAGE TO A FRIEND

RBM48

RNA binding motif protein 48

65 Gene Product Result for
Synonyms: C7orf64 DKFZP564O0523 HSPC304
UniProtKB ID: Q5RL73, B7ZL51, Q5H9T2, Q8IYW7, Q96NS0, Q9H0V7
Gene ID:
Mouse(269623) RNA binding motif protein 48
Rat(296840) RNA binding motif protein 48
Zebrafish(402897) RNA binding motif protein 48
domestic cat(101084272) RNA binding motif protein 48
dog(482302) RNA binding motif protein 48
cow(505408) RNA binding motif protein 48
sheep(101111793) RNA binding motif protein 48
naked mole-rat(101721564) RNA binding motif protein 48
domestic guinea pig(100732225) RNA binding motif protein 48
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032120 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032120 Rosetta Predictions human pricing
NM_001024246 Rosetta Predictions rat pricing
NM_172991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149564 predicted 851
2 SASI_Hs01_00149565 predicted 1029
3 SASI_Hs01_00149566 predicted 604
4 SASI_Hs01_00149568 predicted 239
5 SASI_Hs01_00149569 predicted 630
6 SASI_Hs01_00149570 predicted 255
7 SASI_Hs01_00149571 predicted 367
8 SASI_Hs01_00149573 predicted 975
9 SASI_Hs02_00359324 predicted 434
10 SASI_Hs02_00359325 predicted 935
11 SASI_Hs01_00149567 predicted 700
12 SASI_Hs01_00149572 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054919 predicted 224
2 SASI_Rn01_00054920 predicted 637
3 SASI_Rn01_00054921 predicted 248
4 SASI_Rn01_00054922 predicted 205
5 SASI_Rn01_00054923 predicted 607
6 SASI_Rn01_00054924 predicted 530
7 SASI_Rn01_00054925 predicted 205
8 SASI_Rn01_00054926 predicted 241
9 SASI_Rn01_00054927 predicted 836
10 SASI_Rn02_00202405 predicted 382
11 SASI_Rn01_00054918 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035258 predicted 441
2 SASI_Mm01_00035259 predicted 709
3 SASI_Mm01_00035260 predicted 1023
4 SASI_Mm01_00035262 predicted 458
5 SASI_Mm01_00035263 predicted 883
6 SASI_Mm01_00035264 predicted 503
7 SASI_Mm01_00035265 predicted 1514
8 SASI_Mm01_00035266 predicted 527
9 SASI_Mm01_00035267 predicted 1290
10 SASI_Mm02_00345040 predicted 543
11 SASI_Mm01_00035261 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172991
RBM48 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 48
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-534s1c1
Sequence:CCGGGCTCTGTATGGTGCGATTGAACTCGAGTTCAATCGCACCATACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-1004s1c1
Sequence:CCGGCAGAGTATCAGACTCCTGTAACTCGAGTTACAGGAGTCTGATACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-699s1c1
Sequence:CCGGGCTCCAGAATTTGAGACAGTTCTCGAGAACTGTCTCAAATTCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1702s1c1
Sequence:CCGGGCAAATGTTTCCATCTTTCTTCTCGAGAAGAAAGATGGAAACATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1712s1c1
Sequence:CCGGCCATCTTTCTTGGATCTACATCTCGAGATGTAGATCCAAGAAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172991.2-512s1c1
Sequence:CCGGGAAGGAATTAGTTGAGCGTTTCTCGAGAAACGCTCAACTAATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1741s1c1
Sequence:CCGGGCAGAGACTGTTCTCTTTATACTCGAGTATAAAGAGAACAGTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-1321s1c1
Sequence:CCGGCCTTGAATACAACGGCAACCTCTCGAGAGGTTGCCGTTGTATTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172991.2-1999s1c1
Sequence:CCGGGCAGCATACATAATGTAACTTCTCGAGAAGTTACATTATGTATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172991
RBM48 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 48
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-534s1c1
Sequence:CCGGGCTCTGTATGGTGCGATTGAACTCGAGTTCAATCGCACCATACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-1004s1c1
Sequence:CCGGCAGAGTATCAGACTCCTGTAACTCGAGTTACAGGAGTCTGATACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-699s1c1
Sequence:CCGGGCTCCAGAATTTGAGACAGTTCTCGAGAACTGTCTCAAATTCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1702s1c1
Sequence:CCGGGCAAATGTTTCCATCTTTCTTCTCGAGAAGAAAGATGGAAACATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1712s1c1
Sequence:CCGGCCATCTTTCTTGGATCTACATCTCGAGATGTAGATCCAAGAAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172991.2-512s1c1
Sequence:CCGGGAAGGAATTAGTTGAGCGTTTCTCGAGAAACGCTCAACTAATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1741s1c1
Sequence:CCGGGCAGAGACTGTTCTCTTTATACTCGAGTATAAAGAGAACAGTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-1321s1c1
Sequence:CCGGCCTTGAATACAACGGCAACCTCTCGAGAGGTTGCCGTTGTATTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172991.2-1999s1c1
Sequence:CCGGGCAGCATACATAATGTAACTTCTCGAGAAGTTACATTATGTATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172991
RBM48 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 48
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-534s1c1
Sequence:CCGGGCTCTGTATGGTGCGATTGAACTCGAGTTCAATCGCACCATACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-1004s1c1
Sequence:CCGGCAGAGTATCAGACTCCTGTAACTCGAGTTACAGGAGTCTGATACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-699s1c1
Sequence:CCGGGCTCCAGAATTTGAGACAGTTCTCGAGAACTGTCTCAAATTCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1702s1c1
Sequence:CCGGGCAAATGTTTCCATCTTTCTTCTCGAGAAGAAAGATGGAAACATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1712s1c1
Sequence:CCGGCCATCTTTCTTGGATCTACATCTCGAGATGTAGATCCAAGAAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172991.2-512s1c1
Sequence:CCGGGAAGGAATTAGTTGAGCGTTTCTCGAGAAACGCTCAACTAATTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172991.2-1741s1c1
Sequence:CCGGGCAGAGACTGTTCTCTTTATACTCGAGTATAAAGAGAACAGTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172991.2-1321s1c1
Sequence:CCGGCCTTGAATACAACGGCAACCTCTCGAGAGGTTGCCGTTGTATTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197832    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172991.2-1999s1c1
Sequence:CCGGGCAGCATACATAATGTAACTTCTCGAGAAGTTACATTATGTATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032120
RBM48 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 48
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1578s1c1
Sequence:CCGGCCATACTTAATGTTGCAGAAACTCGAGTTTCTGCAACATTAAGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-1023s1c1
Sequence:CCGGCGGCATAAACTTAAAGAGGTACTCGAGTACCTCTTTAAGTTTATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1494s1c1
Sequence:CCGGCGAACTCCTGACCTTGTGATACTCGAGTATCACAAGGTCAGGAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1391s1c1
Sequence:CCGGCCTCCTGAGTATCTGGGATTACTCGAGTAATCCCAGATACTCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-740s1c1
Sequence:CCGGCCACAATGACTCTTTGCGGAACTCGAGTTCCGCAAAGAGTCATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-267s1c1
Sequence:CCGGCCAGCAGAAGACTTTACTGAACTCGAGTTCAGTAAAGTCTTCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-585s1c1
Sequence:CCGGGCAGGGAACTCAAATCCTTATCTCGAGATAAGGATTTGAGTTCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-217s1c1
Sequence:CCGGGATTCGCTTTATATGGTGCAACTCGAGTTGCACCATATAAAGCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-616s1c1
Sequence:CCGGCCTGTGAATTGCCTTTATGTTCTCGAGAACATAAAGGCAATTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-200s1c1
Sequence:CCGGGAAGGAATTAGTTGAGCGATTCTCGAGAATCGCTCAACTAATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032120.1-1577s1c1
Sequence:CCGGCCCATACTTAATGTTGCAGAACTCGAGTTCTGCAACATTAAGTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032120
RBM48 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 48
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1578s1c1
Sequence:CCGGCCATACTTAATGTTGCAGAAACTCGAGTTTCTGCAACATTAAGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-1023s1c1
Sequence:CCGGCGGCATAAACTTAAAGAGGTACTCGAGTACCTCTTTAAGTTTATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1494s1c1
Sequence:CCGGCGAACTCCTGACCTTGTGATACTCGAGTATCACAAGGTCAGGAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1391s1c1
Sequence:CCGGCCTCCTGAGTATCTGGGATTACTCGAGTAATCCCAGATACTCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-740s1c1
Sequence:CCGGCCACAATGACTCTTTGCGGAACTCGAGTTCCGCAAAGAGTCATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-267s1c1
Sequence:CCGGCCAGCAGAAGACTTTACTGAACTCGAGTTCAGTAAAGTCTTCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-585s1c1
Sequence:CCGGGCAGGGAACTCAAATCCTTATCTCGAGATAAGGATTTGAGTTCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-217s1c1
Sequence:CCGGGATTCGCTTTATATGGTGCAACTCGAGTTGCACCATATAAAGCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-616s1c1
Sequence:CCGGCCTGTGAATTGCCTTTATGTTCTCGAGAACATAAAGGCAATTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-200s1c1
Sequence:CCGGGAAGGAATTAGTTGAGCGATTCTCGAGAATCGCTCAACTAATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032120.1-1577s1c1
Sequence:CCGGCCCATACTTAATGTTGCAGAACTCGAGTTCTGCAACATTAAGTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032120
RBM48 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 48
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1578s1c1
Sequence:CCGGCCATACTTAATGTTGCAGAAACTCGAGTTTCTGCAACATTAAGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-1023s1c1
Sequence:CCGGCGGCATAAACTTAAAGAGGTACTCGAGTACCTCTTTAAGTTTATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139610    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1494s1c1
Sequence:CCGGCGAACTCCTGACCTTGTGATACTCGAGTATCACAAGGTCAGGAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032120.1-1391s1c1
Sequence:CCGGCCTCCTGAGTATCTGGGATTACTCGAGTAATCCCAGATACTCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-740s1c1
Sequence:CCGGCCACAATGACTCTTTGCGGAACTCGAGTTCCGCAAAGAGTCATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-267s1c1
Sequence:CCGGCCAGCAGAAGACTTTACTGAACTCGAGTTCAGTAAAGTCTTCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143528    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-585s1c1
Sequence:CCGGGCAGGGAACTCAAATCCTTATCTCGAGATAAGGATTTGAGTTCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032120.1-217s1c1
Sequence:CCGGGATTCGCTTTATATGGTGCAACTCGAGTTGCACCATATAAAGCGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-616s1c1
Sequence:CCGGCCTGTGAATTGCCTTTATGTTCTCGAGAACATAAAGGCAATTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032120.1-200s1c1
Sequence:CCGGGAAGGAATTAGTTGAGCGATTCTCGAGAATCGCTCAACTAATTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032120.1-1577s1c1
Sequence:CCGGCCCATACTTAATGTTGCAGAACTCGAGTTCTGCAACATTAAGTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)