EMAIL THIS PAGE TO A FRIEND

RBM4B

RNA binding motif protein 4B

55 Gene Product Result for
Synonyms: RBM30 RBM4L ZCCHC15 ZCCHC21B ZCRB3B
UniProtKB ID: Q9BQ04, B3KT83
Gene ID:
Mouse(66704) RNA binding motif protein 4B
Rat(474154) RNA binding motif protein 4B
domestic cat(101088784) RNA binding motif protein 4B
dog(476008) RNA binding motif protein 4B
domestic guinea pig(100718391) RNA binding motif protein 4B
naked mole-rat(101717885) RNA binding motif protein 4B
cow(505756) RNA binding motif protein 4B
sheep(101117545) RNA binding motif protein 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031492 Rosetta Predictions human pricing
NM_001007014 Rosetta Predictions rat pricing
NM_025717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053651 predicted 600
2 SASI_Hs01_00053652 predicted 838
3 SASI_Hs01_00053653 predicted 620
4 SASI_Hs02_00358932 predicted 1218
5 SASI_Hs01_00053655 predicted 632
6 SASI_Hs01_00053656 predicted 1004
7 SASI_Hs01_00053657 predicted 899
8 SASI_Hs01_00053658 predicted 1012
9 SASI_Hs01_00053659 predicted 692
10 SASI_Hs02_00358933 predicted 1221
11 SASI_Hs01_00053650 predicted 1090
12 SASI_Hs01_00053654 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120943 predicted 658
2 SASI_Rn02_00198605 predicted 668
3 SASI_Rn01_00120944 predicted 1115
4 SASI_Rn02_00198606 predicted 854
5 SASI_Rn02_00198607 predicted 904
6 SASI_Rn01_00120946 predicted 537
7 SASI_Rn01_00120947 predicted 592
8 SASI_Rn01_00120951 predicted 1282
9 SASI_Rn02_00198608 predicted 662
10 SASI_Rn01_00120952 predicted 1068
11 SASI_Rn01_00120945 predicted 518
12 SASI_Rn01_00120948 predicted 233
13 SASI_Rn01_00120949 predicted 1140
14 SASI_Rn01_00120950 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094993 predicted 935
2 SASI_Mm01_00094994 predicted 1144
3 SASI_Mm01_00094995 predicted 626
4 SASI_Mm01_00094996 predicted 571
5 SASI_Mm01_00094997 predicted 864
6 SASI_Mm01_00094999 predicted 696
7 SASI_Mm01_00095000 predicted 741
8 SASI_Mm01_00095001 predicted 696
9 SASI_Mm01_00095002 predicted 776
10 SASI_Mm02_00328900 predicted 1314
11 SASI_Mm01_00094998 predicted 1312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031492
VALIDATED
RBM4B MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 4B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000161617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-258s1c1
Sequence:CCGGGCCAGCAAGAATAAGAGCAAACTCGAGTTTGCTCTTATTCTTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031492.2-336s21c1
Sequence:CCGGCGAGCCAAGTTTGAGGAGTATCTCGAGATACTCCTCAAACTTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031492.2-840s21c1
Sequence:CCGGCTCAACTCTACTTCTGTTGATCTCGAGATCAACAGAAGTAGAGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-1332s1c1
Sequence:CCGGCCTTTCACTCTGTTCCTTATACTCGAGTATAAGGAACAGAGTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031492.2-1332s21c1
Sequence:CCGGCCTTTCACTCTGTTCCTTATACTCGAGTATAAGGAACAGAGTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-765s1c1
Sequence:CCGGGCTTCTGCATACAACTACGCACTCGAGTGCGTAGTTGTATGCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-149s1c1
Sequence:CCGGCATCATTAAGAATTACGGCTTCTCGAGAAGCCGTAATTCTTAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-840s1c1
Sequence:CCGGCTCAACTCTACTTCTGTTGATCTCGAGATCAACAGAAGTAGAGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-1230s1c1
Sequence:CCGGGCTTCATGTTTCAGTAAACAACTCGAGTTGTTTACTGAAACATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-336s1c1
Sequence:CCGGCGAGCCAAGTTTGAGGAGTATCTCGAGATACTCCTCAAACTTGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031492.2-1230s21c1
Sequence:CCGGGCTTCATGTTTCAGTAAACAACTCGAGTTGTTTACTGAAACATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031492
VALIDATED
RBM4B MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 4B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000161617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-258s1c1
Sequence:CCGGGCCAGCAAGAATAAGAGCAAACTCGAGTTTGCTCTTATTCTTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031492.2-336s21c1
Sequence:CCGGCGAGCCAAGTTTGAGGAGTATCTCGAGATACTCCTCAAACTTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031492.2-840s21c1
Sequence:CCGGCTCAACTCTACTTCTGTTGATCTCGAGATCAACAGAAGTAGAGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-1332s1c1
Sequence:CCGGCCTTTCACTCTGTTCCTTATACTCGAGTATAAGGAACAGAGTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031492.2-1332s21c1
Sequence:CCGGCCTTTCACTCTGTTCCTTATACTCGAGTATAAGGAACAGAGTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-765s1c1
Sequence:CCGGGCTTCTGCATACAACTACGCACTCGAGTGCGTAGTTGTATGCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-149s1c1
Sequence:CCGGCATCATTAAGAATTACGGCTTCTCGAGAAGCCGTAATTCTTAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-840s1c1
Sequence:CCGGCTCAACTCTACTTCTGTTGATCTCGAGATCAACAGAAGTAGAGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-1230s1c1
Sequence:CCGGGCTTCATGTTTCAGTAAACAACTCGAGTTGTTTACTGAAACATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-336s1c1
Sequence:CCGGCGAGCCAAGTTTGAGGAGTATCTCGAGATACTCCTCAAACTTGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031492.2-1230s21c1
Sequence:CCGGGCTTCATGTTTCAGTAAACAACTCGAGTTGTTTACTGAAACATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031492
VALIDATED
RBM4B MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 4B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000161617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-258s1c1
Sequence:CCGGGCCAGCAAGAATAAGAGCAAACTCGAGTTTGCTCTTATTCTTGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031492.2-336s21c1
Sequence:CCGGCGAGCCAAGTTTGAGGAGTATCTCGAGATACTCCTCAAACTTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031492.2-840s21c1
Sequence:CCGGCTCAACTCTACTTCTGTTGATCTCGAGATCAACAGAAGTAGAGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159492    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-1332s1c1
Sequence:CCGGCCTTTCACTCTGTTCCTTATACTCGAGTATAAGGAACAGAGTGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031492.2-1332s21c1
Sequence:CCGGCCTTTCACTCTGTTCCTTATACTCGAGTATAAGGAACAGAGTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-765s1c1
Sequence:CCGGGCTTCTGCATACAACTACGCACTCGAGTGCGTAGTTGTATGCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-149s1c1
Sequence:CCGGCATCATTAAGAATTACGGCTTCTCGAGAAGCCGTAATTCTTAATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-840s1c1
Sequence:CCGGCTCAACTCTACTTCTGTTGATCTCGAGATCAACAGAAGTAGAGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031492.2-1230s1c1
Sequence:CCGGGCTTCATGTTTCAGTAAACAACTCGAGTTGTTTACTGAAACATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031492.2-336s1c1
Sequence:CCGGCGAGCCAAGTTTGAGGAGTATCTCGAGATACTCCTCAAACTTGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031492.2-1230s21c1
Sequence:CCGGGCTTCATGTTTCAGTAAACAACTCGAGTTGTTTACTGAAACATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025717
RBM4B MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 4B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025717.3-1303s1c1
Sequence:CCGGGCCAGGATGTTTCCATTGCTTCTCGAGAAGCAATGGAAACATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-742s1c1
Sequence:CCGGGCACACCTTATACTATGGGTTCTCGAGAACCCATAGTATAAGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-354s1c1
Sequence:CCGGGCCAGCAAGAATAAGAGCAAACTCGAGTTTGCTCTTATTCTTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-866s1c1
Sequence:CCGGCGCATACAATTACGCAGAGCACTCGAGTGCTCTGCGTAATTGTATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-957s21c1
Sequence:CCGGCCTTATGACAGACACCTATTGCTCGAGCAATAGGTGTCTGTCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-1143s1c1
Sequence:CCGGGCAACTCGGAATTCTCTGTATCTCGAGATACAGAGAATTCCGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025717.3-1341s21c1
Sequence:CCGGAGGAATTTGTGACCAACTATGCTCGAGCATAGTTGGTCACAAATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-793s21c1
Sequence:CCGGATGGAGCACTTGACTACTATACTCGAGTATAGTAGTCAAGTGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-734s21c1
Sequence:CCGGAGCAGTGCGCACACCTTATACCTCGAGGTATAAGGTGTGCGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-1020s21c1
Sequence:CCGGGCCGCTTCCTCTTCCTATTATCTCGAGATAATAGGAAGAGGAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025717
RBM4B MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 4B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025717.3-1303s1c1
Sequence:CCGGGCCAGGATGTTTCCATTGCTTCTCGAGAAGCAATGGAAACATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-742s1c1
Sequence:CCGGGCACACCTTATACTATGGGTTCTCGAGAACCCATAGTATAAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-354s1c1
Sequence:CCGGGCCAGCAAGAATAAGAGCAAACTCGAGTTTGCTCTTATTCTTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-866s1c1
Sequence:CCGGCGCATACAATTACGCAGAGCACTCGAGTGCTCTGCGTAATTGTATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-957s21c1
Sequence:CCGGCCTTATGACAGACACCTATTGCTCGAGCAATAGGTGTCTGTCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-1143s1c1
Sequence:CCGGGCAACTCGGAATTCTCTGTATCTCGAGATACAGAGAATTCCGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025717.3-1341s21c1
Sequence:CCGGAGGAATTTGTGACCAACTATGCTCGAGCATAGTTGGTCACAAATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-793s21c1
Sequence:CCGGATGGAGCACTTGACTACTATACTCGAGTATAGTAGTCAAGTGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-734s21c1
Sequence:CCGGAGCAGTGCGCACACCTTATACCTCGAGGTATAAGGTGTGCGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-1020s21c1
Sequence:CCGGGCCGCTTCCTCTTCCTATTATCTCGAGATAATAGGAAGAGGAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025717
RBM4B MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 4B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025717.3-1303s1c1
Sequence:CCGGGCCAGGATGTTTCCATTGCTTCTCGAGAAGCAATGGAAACATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-742s1c1
Sequence:CCGGGCACACCTTATACTATGGGTTCTCGAGAACCCATAGTATAAGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-354s1c1
Sequence:CCGGGCCAGCAAGAATAAGAGCAAACTCGAGTTTGCTCTTATTCTTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-866s1c1
Sequence:CCGGCGCATACAATTACGCAGAGCACTCGAGTGCTCTGCGTAATTGTATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-957s21c1
Sequence:CCGGCCTTATGACAGACACCTATTGCTCGAGCAATAGGTGTCTGTCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025717.3-1143s1c1
Sequence:CCGGGCAACTCGGAATTCTCTGTATCTCGAGATACAGAGAATTCCGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025717.3-1341s21c1
Sequence:CCGGAGGAATTTGTGACCAACTATGCTCGAGCATAGTTGGTCACAAATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-793s21c1
Sequence:CCGGATGGAGCACTTGACTACTATACTCGAGTATAGTAGTCAAGTGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-734s21c1
Sequence:CCGGAGCAGTGCGCACACCTTATACCTCGAGGTATAAGGTGTGCGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025717.3-1020s21c1
Sequence:CCGGGCCGCTTCCTCTTCCTATTATCTCGAGATAATAGGAAGAGGAAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)