EMAIL THIS PAGE TO A FRIEND

RBM5

RNA binding motif protein 5

200 Gene Product Result for
Synonyms: G15 LUCA15 RMB5
Gene ID:
Human(10181) Summary: This gene is a candidate tumor suppressor gene which encodes a nuclear RNA binding protein that is a component of the spliceosome A complex. The encoded protein plays a role in the induction of cell cycle arrest and apoptosis through pre-mRNA splicing of multiple target genes including the tumor suppressor protein p53. This gene is located within the tumor suppressor region 3p21.3, and may play a role in the inhibition of tumor transformation and progression of several malignancies including lung cancer. [provided by RefSeq, Oct 2011]
Mouse(83486) RNA binding motif protein 5
Rat(300996) RNA binding motif protein 5
cow(534216) RNA binding motif protein 5
sheep(101122469) RNA binding motif protein 5
naked mole-rat(101723983) RNA binding motif protein 5
Domestic Rabbit(100338565) RNA binding motif protein 5
domestic guinea pig(100713968) RNA binding motif protein 5
Zebrafish(324302) RNA binding motif protein 5
Horse(100052535) RNA binding motif protein 5
domestic cat(101091263) RNA binding motif protein 5
dog(476618) RNA binding motif protein 5
chicken(415947) RNA binding motif protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005778 Rosetta Predictions human pricing
NM_001100548 Rosetta Predictions rat pricing
NM_148930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176080 predicted 1520
2 SASI_Hs01_00176081 predicted 645
3 SASI_Hs01_00176082 predicted 1526
4 SASI_Hs01_00176083 predicted 287
5 SASI_Hs01_00176084 predicted 1202
6 SASI_Hs01_00176085 predicted 1485
7 SASI_Hs01_00176086 predicted 1567
8 SASI_Hs01_00176087 predicted 362
9 SASI_Hs01_00176088 predicted 379
10 SASI_Hs01_00176089 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210018 predicted 1970
2 SASI_Rn02_00210019 predicted 988
3 SASI_Rn02_00210020 predicted 782
4 SASI_Rn02_00210021 predicted 2094
5 SASI_Rn02_00210022 predicted 1726
6 SASI_Rn02_00210023 predicted 1057
7 SASI_Rn02_00210024 predicted 508
8 SASI_Rn02_00210025 predicted 667
9 SASI_Rn02_00210026 predicted 526
10 SASI_Rn02_00210027 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342740 predicted 409
2 SASI_Mm01_00132921 predicted 311
3 SASI_Mm01_00132922 predicted 1210
4 SASI_Mm01_00132923 predicted 655
5 SASI_Mm01_00132924 predicted 1559
6 SASI_Mm01_00132925 predicted 2364
7 SASI_Mm01_00132926 predicted 991
8 SASI_Mm02_00342741 predicted 928
9 SASI_Mm01_00132927 predicted 1590
10 SASI_Mm01_00132928 predicted 827
11 SASI_Mm01_00132920 predicted 1845
12 SASI_Mm01_00132929 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005778
VALIDATED
RBM5 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-217s21c1
Sequence:CCGGTGACCGTGATGAGCGTGAATCCTCGAGGATTCACGCTCATCACGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-1596s21c1
Sequence:CCGGACTCGCAATACTACTATAATTCTCGAGAATTATAGTAGTATTGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-680s21c1
Sequence:CCGGCCCAGACCTAAGTTTGAAGATCTCGAGATCTTCAAACTTAGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-1568s21c1
Sequence:CCGGCCGACAACAGGGCTCTATTATCTCGAGATAATAGAGCCCTGTTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-390s21c1
Sequence:CCGGACTATGGTGAGCACGACTATACTCGAGTATAGTCGTGCTCACCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005778.1-680s1c1
Sequence:CCGGCCCAGACCTAAGTTTGAAGATCTCGAGATCTTCAAACTTAGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005778.1-2737s1c1
Sequence:CCGGCCCTCCCACCTTAAAGAAGTTCTCGAGAACTTCTTTAAGGTGGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-1304s1c1
Sequence:CCGGGCTGGAGGATTGGAATCTGATCTCGAGATCAGATTCCAATCCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-764s1c1
Sequence:CCGGGCAGACAAGTTTGACTCTGAACTCGAGTTCAGAGTCAAACTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-910s1c1
Sequence:CCGGCGCGTCTTTAGCTGTCAATAACTCGAGTTATTGACAGCTAAAGACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005778.1-470s21c1
Sequence:CCGGACCATCACAGAGAGCGATATTCTCGAGAATATCGCTCTCTGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005778
VALIDATED
RBM5 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-217s21c1
Sequence:CCGGTGACCGTGATGAGCGTGAATCCTCGAGGATTCACGCTCATCACGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-1596s21c1
Sequence:CCGGACTCGCAATACTACTATAATTCTCGAGAATTATAGTAGTATTGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-680s21c1
Sequence:CCGGCCCAGACCTAAGTTTGAAGATCTCGAGATCTTCAAACTTAGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-1568s21c1
Sequence:CCGGCCGACAACAGGGCTCTATTATCTCGAGATAATAGAGCCCTGTTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-390s21c1
Sequence:CCGGACTATGGTGAGCACGACTATACTCGAGTATAGTCGTGCTCACCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005778.1-680s1c1
Sequence:CCGGCCCAGACCTAAGTTTGAAGATCTCGAGATCTTCAAACTTAGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005778.1-2737s1c1
Sequence:CCGGCCCTCCCACCTTAAAGAAGTTCTCGAGAACTTCTTTAAGGTGGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-1304s1c1
Sequence:CCGGGCTGGAGGATTGGAATCTGATCTCGAGATCAGATTCCAATCCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-764s1c1
Sequence:CCGGGCAGACAAGTTTGACTCTGAACTCGAGTTCAGAGTCAAACTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-910s1c1
Sequence:CCGGCGCGTCTTTAGCTGTCAATAACTCGAGTTATTGACAGCTAAAGACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005778.1-470s21c1
Sequence:CCGGACCATCACAGAGAGCGATATTCTCGAGAATATCGCTCTCTGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005778
VALIDATED
RBM5 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-217s21c1
Sequence:CCGGTGACCGTGATGAGCGTGAATCCTCGAGGATTCACGCTCATCACGGTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000369315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-1596s21c1
Sequence:CCGGACTCGCAATACTACTATAATTCTCGAGAATTATAGTAGTATTGCGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-680s21c1
Sequence:CCGGCCCAGACCTAAGTTTGAAGATCTCGAGATCTTCAAACTTAGGTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-1568s21c1
Sequence:CCGGCCGACAACAGGGCTCTATTATCTCGAGATAATAGAGCCCTGTTGTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005778.1-390s21c1
Sequence:CCGGACTATGGTGAGCACGACTATACTCGAGTATAGTCGTGCTCACCATAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005778.1-680s1c1
Sequence:CCGGCCCAGACCTAAGTTTGAAGATCTCGAGATCTTCAAACTTAGGTCTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005778.1-2737s1c1
Sequence:CCGGCCCTCCCACCTTAAAGAAGTTCTCGAGAACTTCTTTAAGGTGGGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-1304s1c1
Sequence:CCGGGCTGGAGGATTGGAATCTGATCTCGAGATCAGATTCCAATCCTCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-764s1c1
Sequence:CCGGGCAGACAAGTTTGACTCTGAACTCGAGTTCAGAGTCAAACTTGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005778.1-910s1c1
Sequence:CCGGCGCGTCTTTAGCTGTCAATAACTCGAGTTATTGACAGCTAAAGACGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000312602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005778.1-470s21c1
Sequence:CCGGACCATCACAGAGAGCGATATTCTCGAGAATATCGCTCTCTGTGATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148930
VALIDATED
RBM5 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-485s21c1
Sequence:CCGGCGAGAGCGATATTCGAGAAATCTCGAGATTTCTCGAATATCGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-2381s21c1
Sequence:CCGGCCACAGTAACATTGGCAACAACTCGAGTTGTTGCCAATGTTACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148930.2-2474s21c1
Sequence:CCGGTGAGGCTCAAGTCCGACTAAACTCGAGTTTAGTCGGACTTGAGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148930.2-2820s21c1
Sequence:CCGGCTAAGGTGTATATAGTGTAAACTCGAGTTTACACTATATACACCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-2268s21c1
Sequence:CCGGGCAGCAGAAAGACGAGAGAAACTCGAGTTTCTCTCGTCTTTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-485s1c1
Sequence:CCGGCGAGAGCGATATTCGAGAAATCTCGAGATTTCTCGAATATCGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-2268s1c1
Sequence:CCGGGCAGCAGAAAGACGAGAGAAACTCGAGTTTCTCTCGTCTTTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148930.2-366s1c1
Sequence:CCGGCGGTCTGAAGATGGCTATCATCTCGAGATGATAGCCATCTTCAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148930.2-930s1c1
Sequence:CCGGGTCAATAACATTCGCCTCATACTCGAGTATGAGGCGAATGTTATTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-2381s1c1
Sequence:CCGGCCACAGTAACATTGGCAACAACTCGAGTTGTTGCCAATGTTACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148930
VALIDATED
RBM5 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-485s21c1
Sequence:CCGGCGAGAGCGATATTCGAGAAATCTCGAGATTTCTCGAATATCGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-2381s21c1
Sequence:CCGGCCACAGTAACATTGGCAACAACTCGAGTTGTTGCCAATGTTACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148930.2-2474s21c1
Sequence:CCGGTGAGGCTCAAGTCCGACTAAACTCGAGTTTAGTCGGACTTGAGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148930.2-2820s21c1
Sequence:CCGGCTAAGGTGTATATAGTGTAAACTCGAGTTTACACTATATACACCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-2268s21c1
Sequence:CCGGGCAGCAGAAAGACGAGAGAAACTCGAGTTTCTCTCGTCTTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-485s1c1
Sequence:CCGGCGAGAGCGATATTCGAGAAATCTCGAGATTTCTCGAATATCGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-2268s1c1
Sequence:CCGGGCAGCAGAAAGACGAGAGAAACTCGAGTTTCTCTCGTCTTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148930.2-366s1c1
Sequence:CCGGCGGTCTGAAGATGGCTATCATCTCGAGATGATAGCCATCTTCAGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148930.2-930s1c1
Sequence:CCGGGTCAATAACATTCGCCTCATACTCGAGTATGAGGCGAATGTTATTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-2381s1c1
Sequence:CCGGCCACAGTAACATTGGCAACAACTCGAGTTGTTGCCAATGTTACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148930
VALIDATED
RBM5 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-485s21c1
Sequence:CCGGCGAGAGCGATATTCGAGAAATCTCGAGATTTCTCGAATATCGCTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-2381s21c1
Sequence:CCGGCCACAGTAACATTGGCAACAACTCGAGTTGTTGCCAATGTTACTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148930.2-2474s21c1
Sequence:CCGGTGAGGCTCAAGTCCGACTAAACTCGAGTTTAGTCGGACTTGAGCCTCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148930.2-2820s21c1
Sequence:CCGGCTAAGGTGTATATAGTGTAAACTCGAGTTTACACTATATACACCTTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000287687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148930.2-2268s21c1
Sequence:CCGGGCAGCAGAAAGACGAGAGAAACTCGAGTTTCTCTCGTCTTTCTGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-485s1c1
Sequence:CCGGCGAGAGCGATATTCGAGAAATCTCGAGATTTCTCGAATATCGCTCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-2268s1c1
Sequence:CCGGGCAGCAGAAAGACGAGAGAAACTCGAGTTTCTCTCGTCTTTCTGCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148930.2-366s1c1
Sequence:CCGGCGGTCTGAAGATGGCTATCATCTCGAGATGATAGCCATCTTCAGACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148930.2-930s1c1
Sequence:CCGGGTCAATAACATTCGCCTCATACTCGAGTATGAGGCGAATGTTATTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148930.2-2381s1c1
Sequence:CCGGCCACAGTAACATTGGCAACAACTCGAGTTGTTGCCAATGTTACTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???