EMAIL THIS PAGE TO A FRIEND

RBM8A

RNA binding motif protein 8A

101 Gene Product Result for
Synonyms: BOV-1A BOV-1B BOV-1C C1DELq21.1 DEL1q21.1 MDS014 RBM8 RBM8B TAR Y14 ZNRP ZRNP1
UniProtKB ID: Q9Y5S9, B3KQI9, Q6FHD1, Q6IQ40, Q9GZX8, Q9NZI4
Gene ID:
Human(9939) Summary: This gene encodes a protein with a conserved RNA-binding motif. The protein is found predominantly in the nucleus, although it is also present in the cytoplasm. It is preferentially associated with mRNAs produced by splicing, including both nuclear mRNAs and newly exported cytoplasmic mRNAs. It is thought that the protein remains associated with spliced mRNAs as a tag to indicate where introns had been present, thus coupling pre- and post-mRNA splicing events. Previously, it was thought that two genes encode this protein, RBM8A and RBM8B; it is now thought that the RBM8B locus is a pseudogene. There are two alternate translation start codons with this gene, which result in two forms of the protein. An allele mutation and a low-frequency noncoding single-nucleotide polymorphism (SNP) in this gene cause thrombocytopenia-absent radius (TAR) syndrome. [provided by RefSeq, Jul 2013]
Mouse(60365) RNA binding motif protein 8a
Rat(295284) RNA binding motif protein 8A
Zebrafish(503767) RNA binding motif protein 8A
domestic cat(101098563) RNA binding motif protein 8A
Horse(100034052) RNA binding motif protein 8A
dog(475827) RNA binding motif protein 8A
domestic guinea pig(100731698) RNA binding motif protein 8A
naked mole-rat(101702668) RNA binding motif protein 8A
cow(518045) RNA binding motif protein 8A
sheep(101117890) RNA binding motif protein 8A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107979 Anti-RBM8A antibody produced in rabbit IgG fraction of antiserum rat, zebrafish, rabbit, human, pig, horse, mouse, canine, bovine
immunohistochemistry, western blot pricing
HPA018403 Anti-RBM8A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV40576 Anti-RBM8A antibody produced in rabbit IgG fraction of antiserum, lyophilized powder mouse, bovine, canine, zebrafish, human, rat,
immunohistochemistry, western blot pricing
Y1253 Anti-Y14 antibody, Mouse monoclonal clone 4C4, purified from hybridoma cell culture human, Xenopus
ELISA, immunocytochemistry, immunoprecipitation (IP), microarray, western blot pricing
SAB1402489 Monoclonal Anti-RBM8A antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005105 Rosetta Predictions human pricing
XM_001059872 Rosetta Predictions rat pricing
XM_215637 Rosetta Predictions rat pricing
NM_001102407 Rosetta Predictions mouse pricing
NM_025875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093088 predicted 410
2 SASI_Hs01_00093096 predicted 374
3 SASI_Hs01_00093092 predicted 707
4 SASI_Hs01_00093097 predicted 664
5 SASI_Hs02_00338991 predicted 764
6 SASI_Hs02_00338992 predicted 759
7 SASI_Hs01_00093090 predicted 654
8 SASI_Hs01_00093091 predicted 772
9 SASI_Hs01_00093093 predicted 630
10 SASI_Hs01_00093094 predicted 658
11 SASI_Hs01_00093089 predicted 253
12 SASI_Hs01_00093095 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294664 predicted 287
2 SASI_Rn02_00294665 predicted 633
3 SASI_Rn02_00294666 predicted 617
4 SASI_Rn02_00294667 predicted 840
5 SASI_Rn02_00294668 predicted 726
6 SASI_Rn02_00294669 predicted 271
7 SASI_Rn02_00294670 predicted 722
8 SASI_Rn02_00294671 predicted 374
9 SASI_Rn02_00294672 predicted 634
10 SASI_Rn02_00294673 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376125 predicted 287
2 SASI_Rn02_00376126 predicted 631
3 SASI_Rn02_00376127 predicted 617
4 SASI_Rn02_00376128 predicted 842
5 SASI_Rn02_00376129 predicted 726
6 SASI_Rn02_00376130 predicted 274
7 SASI_Rn02_00376131 predicted 727
8 SASI_Rn02_00376132 predicted 376
9 SASI_Rn02_00376133 predicted 641
10 SASI_Rn02_00376134 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302704 predicted 765
2 SASI_Mm02_00302705 predicted 801
3 SASI_Mm02_00302706 predicted 999
4 SASI_Mm02_00302707 predicted 768
5 SASI_Mm02_00302708 predicted 807
6 SASI_Mm02_00302709 predicted 786
7 SASI_Mm02_00302710 predicted 998
8 SASI_Mm02_00302711 predicted 895
9 SASI_Mm02_00302712 predicted 826
10 SASI_Mm02_00302713 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126190 predicted 757
2 SASI_Mm02_00329197 predicted 800
3 SASI_Mm01_00126191 predicted 994
4 SASI_Mm01_00126194 predicted 771
5 SASI_Mm01_00126196 predicted 803
6 SASI_Mm02_00329198 predicted 782
7 SASI_Mm02_00329199 predicted 989
8 SASI_Mm02_00329200 predicted 887
9 SASI_Mm02_00329201 predicted 818
10 SASI_Mm01_00126189 predicted 837
11 SASI_Mm01_00126187 predicted 230
12 SASI_Mm01_00126188 predicted 299
13 SASI_Mm01_00126192 predicted 422
14 SASI_Mm01_00126193 predicted 234
15 SASI_Mm01_00126195 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025875
VALIDATED
RBM8A MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 8A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-293s1c1
Sequence:CCGGCCATGACAAATTCGCTGAATACTCGAGTATTCAGCGAATTTGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025875.1-420s1c1
Sequence:CCGGGAAGGACTAAATGGTCAAGATCTCGAGATCTTGACCATTTAGTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-228s1c1
Sequence:CCGGCGCTCTGTTGAAGGTTGGATTCTCGAGAATCCAACCTTCAACAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025875.1-625s1c1
Sequence:CCGGGCGGACCTTGTGTTTATATTTCTCGAGAAATATAAACACAAGGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-411s1c1
Sequence:CCGGGCTGCCATGGAAGGACTAAATCTCGAGATTTAGTCCTTCCATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-822s21c1
Sequence:CCGGGAAAGGCTCATGGAGACTGTTCTCGAGAACAGTCTCCATGAGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-916s21c1
Sequence:CCGGGCATAACTCTTGTGAGCAGATCTCGAGATCTGCTCACAAGAGTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-774s21c1
Sequence:CCGGGAATGATTGTGAAGATCCTTCCTCGAGGAAGGATCTTCACAATCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-1012s21c1
Sequence:CCGGAGCCTACTCTATGTTGAATATCTCGAGATATTCAACATAGAGTAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-934s21c1
Sequence:CCGGGATGTTATATTAGTGTCTCTTCTCGAGAAGAGACACTAATATAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025875
VALIDATED
RBM8A MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 8A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-293s1c1
Sequence:CCGGCCATGACAAATTCGCTGAATACTCGAGTATTCAGCGAATTTGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025875.1-420s1c1
Sequence:CCGGGAAGGACTAAATGGTCAAGATCTCGAGATCTTGACCATTTAGTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-228s1c1
Sequence:CCGGCGCTCTGTTGAAGGTTGGATTCTCGAGAATCCAACCTTCAACAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025875.1-625s1c1
Sequence:CCGGGCGGACCTTGTGTTTATATTTCTCGAGAAATATAAACACAAGGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-411s1c1
Sequence:CCGGGCTGCCATGGAAGGACTAAATCTCGAGATTTAGTCCTTCCATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-822s21c1
Sequence:CCGGGAAAGGCTCATGGAGACTGTTCTCGAGAACAGTCTCCATGAGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-916s21c1
Sequence:CCGGGCATAACTCTTGTGAGCAGATCTCGAGATCTGCTCACAAGAGTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-774s21c1
Sequence:CCGGGAATGATTGTGAAGATCCTTCCTCGAGGAAGGATCTTCACAATCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-1012s21c1
Sequence:CCGGAGCCTACTCTATGTTGAATATCTCGAGATATTCAACATAGAGTAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-934s21c1
Sequence:CCGGGATGTTATATTAGTGTCTCTTCTCGAGAAGAGACACTAATATAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025875
VALIDATED
RBM8A MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 8A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-293s1c1
Sequence:CCGGCCATGACAAATTCGCTGAATACTCGAGTATTCAGCGAATTTGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025875.1-420s1c1
Sequence:CCGGGAAGGACTAAATGGTCAAGATCTCGAGATCTTGACCATTTAGTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-228s1c1
Sequence:CCGGCGCTCTGTTGAAGGTTGGATTCTCGAGAATCCAACCTTCAACAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025875.1-625s1c1
Sequence:CCGGGCGGACCTTGTGTTTATATTTCTCGAGAAATATAAACACAAGGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025875.1-411s1c1
Sequence:CCGGGCTGCCATGGAAGGACTAAATCTCGAGATTTAGTCCTTCCATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-822s21c1
Sequence:CCGGGAAAGGCTCATGGAGACTGTTCTCGAGAACAGTCTCCATGAGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-916s21c1
Sequence:CCGGGCATAACTCTTGTGAGCAGATCTCGAGATCTGCTCACAAGAGTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-774s21c1
Sequence:CCGGGAATGATTGTGAAGATCCTTCCTCGAGGAAGGATCTTCACAATCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-1012s21c1
Sequence:CCGGAGCCTACTCTATGTTGAATATCTCGAGATATTCAACATAGAGTAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025875.2-934s21c1
Sequence:CCGGGATGTTATATTAGTGTCTCTTCTCGAGAAGAGACACTAATATAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005105
VALIDATED
RBM8A MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein 8A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000038919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005105.2-1791s1c1
Sequence:CCGGCCAGGGATTATGATAGAAATACTCGAGTATTTCTATCATAATCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005105.2-284s1c1
Sequence:CCGGCGAAGAAGACATACACGACAACTCGAGTTGTCGTGTATGTCTTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005105.2-231s1c1
Sequence:CCGGCGCTCTGTTGAAGGCTGGATTCTCGAGAATCCAGCCTTCAACAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005105.2-458s1c1
Sequence:CCGGCATCAGCGTTGACTGGTGTTTCTCGAGAAACACCAGTCAACGCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005105
VALIDATED
RBM8A MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein 8A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000038919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005105.2-1791s1c1
Sequence:CCGGCCAGGGATTATGATAGAAATACTCGAGTATTTCTATCATAATCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005105.2-284s1c1
Sequence:CCGGCGAAGAAGACATACACGACAACTCGAGTTGTCGTGTATGTCTTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005105.2-231s1c1
Sequence:CCGGCGCTCTGTTGAAGGCTGGATTCTCGAGAATCCAGCCTTCAACAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005105.2-458s1c1
Sequence:CCGGCATCAGCGTTGACTGGTGTTTCTCGAGAAACACCAGTCAACGCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005105
VALIDATED
RBM8A MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein 8A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000038919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005105.2-1791s1c1
Sequence:CCGGCCAGGGATTATGATAGAAATACTCGAGTATTTCTATCATAATCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005105.2-284s1c1
Sequence:CCGGCGAAGAAGACATACACGACAACTCGAGTTGTCGTGTATGTCTTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005105.2-231s1c1
Sequence:CCGGCGCTCTGTTGAAGGCTGGATTCTCGAGAATCCAGCCTTCAACAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005105.2-458s1c1
Sequence:CCGGCATCAGCGTTGACTGGTGTTTCTCGAGAAACACCAGTCAACGCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)