EMAIL THIS PAGE TO A FRIEND

RBMS2

RNA binding motif, single stranded interacting protein 2

87 Gene Product Result for
Synonyms: SCR3
UniProtKB ID: Q15434
Gene ID:
Human(5939) Summary: The protein encoded by this gene is a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. The RBMS proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. This protein was isolated by phenotypic complementation of cdc2 and cdc13 mutants of yeast and is thought to suppress cdc2 and cdc13 mutants through the induction of translation of cdc2. [provided by RefSeq, Jul 2008]
Mouse(56516) RNA binding motif, single stranded interacting protein 2
Rat(288771) RNA binding motif, single stranded interacting protein 2
domestic cat(101101486) RNA binding motif, single stranded interacting protein 2
Horse(100052627) RNA binding motif, single stranded interacting protein 2
dog(481115) RNA binding motif, single stranded interacting protein 2
domestic guinea pig(100731406) RNA binding motif, single stranded interacting protein 2
Domestic Rabbit(100352830) RNA binding motif, single stranded interacting protein 2
naked mole-rat(101703323) RNA binding motif, single stranded interacting protein 2
cow(509798) RNA binding motif, single stranded interacting protein 2
sheep(101107010) RNA binding motif, single stranded interacting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002898 Rosetta Predictions human pricing
NM_001025403 Rosetta Predictions rat pricing
NM_001039080 Rosetta Predictions mouse pricing
NM_019711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166948 predicted 1172
2 SASI_Hs01_00166949 predicted 315
3 SASI_Hs01_00166950 predicted 551
4 SASI_Hs02_00334706 predicted 1316
5 SASI_Hs01_00166952 predicted 1167
6 SASI_Hs01_00166953 predicted 325
7 SASI_Hs01_00166954 predicted 279
8 SASI_Hs01_00166955 predicted 303
9 SASI_Hs01_00166956 predicted 1136
10 SASI_Hs01_00166957 predicted 507
11 SASI_Hs01_00166951 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090157 predicted 997
2 SASI_Rn01_00090158 predicted 476
3 SASI_Rn01_00090160 predicted 787
4 SASI_Rn01_00090161 predicted 781
5 SASI_Rn01_00090162 predicted 1014
6 SASI_Rn01_00090164 predicted 812
7 SASI_Rn01_00090165 predicted 735
8 SASI_Rn01_00090166 predicted 577
9 SASI_Rn02_00203136 predicted 557
10 SASI_Rn02_00203137 predicted 677
11 SASI_Rn01_00090159 predicted 769
12 SASI_Rn01_00090163 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187776 predicted 693
2 SASI_Mm01_00187777 predicted 1193
3 SASI_Mm01_00187778 predicted 1117
4 SASI_Mm01_00187779 predicted 1115
5 SASI_Mm01_00187780 predicted 1130
6 SASI_Mm01_00187781 predicted 1095
7 SASI_Mm01_00187782 predicted 736
8 SASI_Mm01_00187783 predicted 1284
9 SASI_Mm01_00187784 predicted 968
10 SASI_Mm01_00187785 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064351 predicted 511
2 SASI_Mm01_00064352 predicted 1016
3 SASI_Mm01_00064353 predicted 927
4 SASI_Mm01_00064354 predicted 930
5 SASI_Mm01_00064355 predicted 940
6 SASI_Mm01_00064356 predicted 909
7 SASI_Mm01_00064357 predicted 549
8 SASI_Mm01_00064358 predicted 1104
9 SASI_Mm01_00064359 predicted 786
10 SASI_Mm01_00064360 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019711
RBMS2 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif, single stranded interacting protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-552s21c1
Sequence:CCGGGCAAGACCCTACAAACTTATACTCGAGTATAAGTTTGTAGGGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019711.1-1167s1c1
Sequence:CCGGCCTTTCCAGTTCAGCAAATAACTCGAGTTATTTGCTGAACTGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-433s1c1
Sequence:CCGGGCAAGACCCTACAAACTTATACTCGAGTATAAGTTTGTAGGGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-963s1c1
Sequence:CCGGGCCTCCATGATGGGACCTCTTCTCGAGAAGAGGTCCCATCATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-618s1c1
Sequence:CCGGCCCACTTTAATGGAAAGTATACTCGAGTATACTTTCCATTAAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-76s1c1
Sequence:CCGGTGGCTATAACAAGAACAACAACTCGAGTTGTTGTTCTTGTTATAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-737s21c1
Sequence:CCGGCCCACTTTAATGGAAAGTATACTCGAGTATACTTTCCATTAAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-1285s21c1
Sequence:CCGGCCTTTCCAGTTCAGCAAATAACTCGAGTTATTTGCTGAACTGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-195s21c1
Sequence:CCGGTGGCTATAACAAGAACAACAACTCGAGTTGTTGTTCTTGTTATAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-1081s21c1
Sequence:CCGGGCCTCCATGATGGGACCTCTTCTCGAGAAGAGGTCCCATCATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019711
RBMS2 MISSION shRNA shRNA Plasmid DNA
RNA binding motif, single stranded interacting protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-552s21c1
Sequence:CCGGGCAAGACCCTACAAACTTATACTCGAGTATAAGTTTGTAGGGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019711.1-1167s1c1
Sequence:CCGGCCTTTCCAGTTCAGCAAATAACTCGAGTTATTTGCTGAACTGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-433s1c1
Sequence:CCGGGCAAGACCCTACAAACTTATACTCGAGTATAAGTTTGTAGGGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-963s1c1
Sequence:CCGGGCCTCCATGATGGGACCTCTTCTCGAGAAGAGGTCCCATCATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-618s1c1
Sequence:CCGGCCCACTTTAATGGAAAGTATACTCGAGTATACTTTCCATTAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-76s1c1
Sequence:CCGGTGGCTATAACAAGAACAACAACTCGAGTTGTTGTTCTTGTTATAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-737s21c1
Sequence:CCGGCCCACTTTAATGGAAAGTATACTCGAGTATACTTTCCATTAAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-1285s21c1
Sequence:CCGGCCTTTCCAGTTCAGCAAATAACTCGAGTTATTTGCTGAACTGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-195s21c1
Sequence:CCGGTGGCTATAACAAGAACAACAACTCGAGTTGTTGTTCTTGTTATAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-1081s21c1
Sequence:CCGGGCCTCCATGATGGGACCTCTTCTCGAGAAGAGGTCCCATCATGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019711
RBMS2 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif, single stranded interacting protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-552s21c1
Sequence:CCGGGCAAGACCCTACAAACTTATACTCGAGTATAAGTTTGTAGGGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019711.1-1167s1c1
Sequence:CCGGCCTTTCCAGTTCAGCAAATAACTCGAGTTATTTGCTGAACTGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-433s1c1
Sequence:CCGGGCAAGACCCTACAAACTTATACTCGAGTATAAGTTTGTAGGGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-963s1c1
Sequence:CCGGGCCTCCATGATGGGACCTCTTCTCGAGAAGAGGTCCCATCATGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-618s1c1
Sequence:CCGGCCCACTTTAATGGAAAGTATACTCGAGTATACTTTCCATTAAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019711.1-76s1c1
Sequence:CCGGTGGCTATAACAAGAACAACAACTCGAGTTGTTGTTCTTGTTATAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-737s21c1
Sequence:CCGGCCCACTTTAATGGAAAGTATACTCGAGTATACTTTCCATTAAAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-1285s21c1
Sequence:CCGGCCTTTCCAGTTCAGCAAATAACTCGAGTTATTTGCTGAACTGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-195s21c1
Sequence:CCGGTGGCTATAACAAGAACAACAACTCGAGTTGTTGTTCTTGTTATAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019711.2-1081s21c1
Sequence:CCGGGCCTCCATGATGGGACCTCTTCTCGAGAAGAGGTCCCATCATGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002898
VALIDATED
RBMS2 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif, single stranded interacting protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000220046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002898.2-1636s1c1
Sequence:CCGGGGTCGCAGCTTCTCATCTATACTCGAGTATAGATGAGAAGCTGCGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002898.2-1287s21c1
Sequence:CCGGCTTTCCAGTTCAACAAGTAACCTCGAGGTTACTTGTTGAACTGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-298s1c1
Sequence:CCGGCAAATGTAAAGGCTATGGCTTCTCGAGAAGCCATAGCCTTTACATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-259s1c1
Sequence:CCGGGATTGTTTCCACTAAGGCCATCTCGAGATGGCCTTAGTGGAAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-292s1c1
Sequence:CCGGCACAAACAAATGTAAAGGCTACTCGAGTAGCCTTTACATTTGTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.2-1129s1c1
Sequence:CCGGCAGCAGCACAGGCACGTATATCTCGAGATATACGTGCCTGTGCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-712s21c1
Sequence:CCGGCGATCCCTTGCTTTGCAAATTCTCGAGAATTTGCAAAGCAAGGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-998s21c1
Sequence:CCGGTGGATGCACCACCATTCATACCTCGAGGTATGAATGGTGGTGCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-1477s21c1
Sequence:CCGGACGTTCCTGCCCTTTACTATTCTCGAGAATAGTAAAGGGCAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002898
VALIDATED
RBMS2 MISSION shRNA shRNA Plasmid DNA
RNA binding motif, single stranded interacting protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000220046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002898.2-1636s1c1
Sequence:CCGGGGTCGCAGCTTCTCATCTATACTCGAGTATAGATGAGAAGCTGCGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002898.2-1287s21c1
Sequence:CCGGCTTTCCAGTTCAACAAGTAACCTCGAGGTTACTTGTTGAACTGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-298s1c1
Sequence:CCGGCAAATGTAAAGGCTATGGCTTCTCGAGAAGCCATAGCCTTTACATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-259s1c1
Sequence:CCGGGATTGTTTCCACTAAGGCCATCTCGAGATGGCCTTAGTGGAAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-292s1c1
Sequence:CCGGCACAAACAAATGTAAAGGCTACTCGAGTAGCCTTTACATTTGTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.2-1129s1c1
Sequence:CCGGCAGCAGCACAGGCACGTATATCTCGAGATATACGTGCCTGTGCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-712s21c1
Sequence:CCGGCGATCCCTTGCTTTGCAAATTCTCGAGAATTTGCAAAGCAAGGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-998s21c1
Sequence:CCGGTGGATGCACCACCATTCATACCTCGAGGTATGAATGGTGGTGCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-1477s21c1
Sequence:CCGGACGTTCCTGCCCTTTACTATTCTCGAGAATAGTAAAGGGCAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002898
VALIDATED
RBMS2 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif, single stranded interacting protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000220046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002898.2-1636s1c1
Sequence:CCGGGGTCGCAGCTTCTCATCTATACTCGAGTATAGATGAGAAGCTGCGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002898.2-1287s21c1
Sequence:CCGGCTTTCCAGTTCAACAAGTAACCTCGAGGTTACTTGTTGAACTGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-298s1c1
Sequence:CCGGCAAATGTAAAGGCTATGGCTTCTCGAGAAGCCATAGCCTTTACATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-259s1c1
Sequence:CCGGGATTGTTTCCACTAAGGCCATCTCGAGATGGCCTTAGTGGAAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.1-292s1c1
Sequence:CCGGCACAAACAAATGTAAAGGCTACTCGAGTAGCCTTTACATTTGTTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002898.2-1129s1c1
Sequence:CCGGCAGCAGCACAGGCACGTATATCTCGAGATATACGTGCCTGTGCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-712s21c1
Sequence:CCGGCGATCCCTTGCTTTGCAAATTCTCGAGAATTTGCAAAGCAAGGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-998s21c1
Sequence:CCGGTGGATGCACCACCATTCATACCTCGAGGTATGAATGGTGGTGCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002898.2-1477s21c1
Sequence:CCGGACGTTCCTGCCCTTTACTATTCTCGAGAATAGTAAAGGGCAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)