EMAIL THIS PAGE TO A FRIEND

RBMX2

RNA binding motif protein, X-linked 2

50 Gene Product Result for
Synonyms: CGI-79
UniProtKB ID: Q9Y388, A8K9Z0, Q5JY82, Q9Y3I8
Gene ID:
Mouse(209003) RNA binding motif protein, X-linked 2
Rat(367930) RNA binding motif protein, X-linked 2
cow(613705) RNA binding motif protein, X-linked 2
naked mole-rat(101703089) RNA binding motif protein, X-linked 2
domestic guinea pig(100734308) RNA binding motif protein, X-linked 2
Zebrafish(553240) RNA binding motif protein, X-linked 2
dog(492135) RNA binding motif protein, X-linked 2
domestic cat(101090999) RNA binding motif protein, X-linked 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016024 Rosetta Predictions human pricing
NM_001113786 Rosetta Predictions rat pricing
NM_173376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071503 predicted 1227
2 SASI_Hs01_00071504 predicted 948
3 SASI_Hs01_00071505 predicted 1218
4 SASI_Hs01_00071506 predicted 919
5 SASI_Hs01_00071507 predicted 930
6 SASI_Hs01_00071510 predicted 878
7 SASI_Hs01_00071508 predicted 1143
8 SASI_Hs01_00071509 predicted 802
9 SASI_Hs01_00071512 predicted 1090
10 SASI_Hs02_00348716 predicted 297
11 SASI_Hs01_00071511 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252113 predicted 218
2 SASI_Rn02_00252114 predicted 235
3 SASI_Rn02_00252115 predicted 797
4 SASI_Rn02_00252116 predicted 763
5 SASI_Rn02_00252117 predicted 239
6 SASI_Rn02_00252118 predicted 741
7 SASI_Rn02_00252119 predicted 197
8 SASI_Rn02_00252120 predicted 756
9 SASI_Rn02_00252121 predicted 245
10 SASI_Rn02_00252122 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345187 predicted 1353
2 SASI_Mm02_00345188 predicted 1471
3 SASI_Mm02_00345189 predicted 1329
4 SASI_Mm02_00345190 predicted 1157
5 SASI_Mm02_00345191 predicted 264
6 SASI_Mm02_00345192 predicted 1322
7 SASI_Mm02_00345193 predicted 1309
8 SASI_Mm02_00345194 predicted 1238
9 SASI_Mm02_00345195 predicted 1391
10 SASI_Mm02_00345196 predicted 1495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016024
VALIDATED
RBMX2 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-333s21c1
Sequence:CCGGCAATTCTGGCCGTCGACAATTCTCGAGAATTGTCGACGGCCAGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016024.2-1042s21c1
Sequence:CCGGGCTGCACAGTAGATTTGGAAACTCGAGTTTCCAAATCTACTGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-935s21c1
Sequence:CCGGAGTAGAAGTAGGAGCCGAGATCTCGAGATCTCGGCTCCTACTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-1083s1c1
Sequence:CCGGCCCTTGACTATTTAGAGTCATCTCGAGATGACTCTAAATAGTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-819s1c1
Sequence:CCGGGATGCACATTCTAGCTGGTATCTCGAGATACCAGCTAGAATGTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-870s1c1
Sequence:CCGGAGTAGAAGTAGGAGCCGAGATCTCGAGATCTCGGCTCCTACTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016024.1-954s1c1
Sequence:CCGGCGTTGGCGTCACTGAAGACTTCTCGAGAAGTCTTCAGTGACGCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-977s1c1
Sequence:CCGGGCTGCACAGTAGATTTGGAAACTCGAGTTTCCAAATCTACTGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-884s21c1
Sequence:CCGGGATGCACATTCTAGCTGGTATCTCGAGATACCAGCTAGAATGTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016024
VALIDATED
RBMX2 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-333s21c1
Sequence:CCGGCAATTCTGGCCGTCGACAATTCTCGAGAATTGTCGACGGCCAGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016024.2-1042s21c1
Sequence:CCGGGCTGCACAGTAGATTTGGAAACTCGAGTTTCCAAATCTACTGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-935s21c1
Sequence:CCGGAGTAGAAGTAGGAGCCGAGATCTCGAGATCTCGGCTCCTACTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-1083s1c1
Sequence:CCGGCCCTTGACTATTTAGAGTCATCTCGAGATGACTCTAAATAGTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-819s1c1
Sequence:CCGGGATGCACATTCTAGCTGGTATCTCGAGATACCAGCTAGAATGTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-870s1c1
Sequence:CCGGAGTAGAAGTAGGAGCCGAGATCTCGAGATCTCGGCTCCTACTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016024.1-954s1c1
Sequence:CCGGCGTTGGCGTCACTGAAGACTTCTCGAGAAGTCTTCAGTGACGCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-977s1c1
Sequence:CCGGGCTGCACAGTAGATTTGGAAACTCGAGTTTCCAAATCTACTGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-884s21c1
Sequence:CCGGGATGCACATTCTAGCTGGTATCTCGAGATACCAGCTAGAATGTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016024
VALIDATED
RBMX2 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-333s21c1
Sequence:CCGGCAATTCTGGCCGTCGACAATTCTCGAGAATTGTCGACGGCCAGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016024.2-1042s21c1
Sequence:CCGGGCTGCACAGTAGATTTGGAAACTCGAGTTTCCAAATCTACTGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-935s21c1
Sequence:CCGGAGTAGAAGTAGGAGCCGAGATCTCGAGATCTCGGCTCCTACTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-1083s1c1
Sequence:CCGGCCCTTGACTATTTAGAGTCATCTCGAGATGACTCTAAATAGTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-819s1c1
Sequence:CCGGGATGCACATTCTAGCTGGTATCTCGAGATACCAGCTAGAATGTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-870s1c1
Sequence:CCGGAGTAGAAGTAGGAGCCGAGATCTCGAGATCTCGGCTCCTACTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016024.1-954s1c1
Sequence:CCGGCGTTGGCGTCACTGAAGACTTCTCGAGAAGTCTTCAGTGACGCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016024.1-977s1c1
Sequence:CCGGGCTGCACAGTAGATTTGGAAACTCGAGTTTCCAAATCTACTGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016024.2-884s21c1
Sequence:CCGGGATGCACATTCTAGCTGGTATCTCGAGATACCAGCTAGAATGTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173376
VALIDATED
RBMX2 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-1340s21c1
Sequence:CCGGCCTCTGATTTAAGATGAGATTCTCGAGAATCTCATCTTAAATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-998s21c1
Sequence:CCGGAGGAGTAGGAGTCCAGATAAGCTCGAGCTTATCTGGACTCCTACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-385s21c1
Sequence:CCGGTCTGGCTGTTGACAATTTCAACTCGAGTTGAAATTGTCAACAGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173376.3-188s21c1
Sequence:CCGGGTGTCTTGGCACTCGGAATACCTCGAGGTATTCCGAGTGCCAAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173376.1-240s1c1
Sequence:CCGGCTTCCTTATGAATTGACAGAACTCGAGTTCTGTCAATTCATAAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-438s21c1
Sequence:CCGGTGGACCATGTGTCAAACTACCCTCGAGGGTAGTTTGACACATGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-1341s1c1
Sequence:CCGGCCTCTGATTTAAGATGAGATTCTCGAGAATCTCATCTTAAATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173376.1-391s1c1
Sequence:CCGGCTGTTGACAATTTCAATGGAACTCGAGTTCCATTGAAATTGTCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-386s1c1
Sequence:CCGGTCTGGCTGTTGACAATTTCAACTCGAGTTGAAATTGTCAACAGCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-982s1c1
Sequence:CCGGGCCATAGAAGTAGAAGTAGGACTCGAGTCCTACTTCTACTTCTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173376
VALIDATED
RBMX2 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-1340s21c1
Sequence:CCGGCCTCTGATTTAAGATGAGATTCTCGAGAATCTCATCTTAAATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-998s21c1
Sequence:CCGGAGGAGTAGGAGTCCAGATAAGCTCGAGCTTATCTGGACTCCTACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-385s21c1
Sequence:CCGGTCTGGCTGTTGACAATTTCAACTCGAGTTGAAATTGTCAACAGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173376.3-188s21c1
Sequence:CCGGGTGTCTTGGCACTCGGAATACCTCGAGGTATTCCGAGTGCCAAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173376.1-240s1c1
Sequence:CCGGCTTCCTTATGAATTGACAGAACTCGAGTTCTGTCAATTCATAAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-438s21c1
Sequence:CCGGTGGACCATGTGTCAAACTACCCTCGAGGGTAGTTTGACACATGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-1341s1c1
Sequence:CCGGCCTCTGATTTAAGATGAGATTCTCGAGAATCTCATCTTAAATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173376.1-391s1c1
Sequence:CCGGCTGTTGACAATTTCAATGGAACTCGAGTTCCATTGAAATTGTCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-386s1c1
Sequence:CCGGTCTGGCTGTTGACAATTTCAACTCGAGTTGAAATTGTCAACAGCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-982s1c1
Sequence:CCGGGCCATAGAAGTAGAAGTAGGACTCGAGTCCTACTTCTACTTCTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173376
VALIDATED
RBMX2 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-1340s21c1
Sequence:CCGGCCTCTGATTTAAGATGAGATTCTCGAGAATCTCATCTTAAATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-998s21c1
Sequence:CCGGAGGAGTAGGAGTCCAGATAAGCTCGAGCTTATCTGGACTCCTACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-385s21c1
Sequence:CCGGTCTGGCTGTTGACAATTTCAACTCGAGTTGAAATTGTCAACAGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173376.3-188s21c1
Sequence:CCGGGTGTCTTGGCACTCGGAATACCTCGAGGTATTCCGAGTGCCAAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173376.1-240s1c1
Sequence:CCGGCTTCCTTATGAATTGACAGAACTCGAGTTCTGTCAATTCATAAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_173376.3-438s21c1
Sequence:CCGGTGGACCATGTGTCAAACTACCCTCGAGGGTAGTTTGACACATGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-1341s1c1
Sequence:CCGGCCTCTGATTTAAGATGAGATTCTCGAGAATCTCATCTTAAATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173376.1-391s1c1
Sequence:CCGGCTGTTGACAATTTCAATGGAACTCGAGTTCCATTGAAATTGTCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-386s1c1
Sequence:CCGGTCTGGCTGTTGACAATTTCAACTCGAGTTGAAATTGTCAACAGCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_173376.1-982s1c1
Sequence:CCGGGCCATAGAAGTAGAAGTAGGACTCGAGTCCTACTTCTACTTCTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)