EMAIL THIS PAGE TO A FRIEND

RBMX

RNA binding motif protein, X-linked

68 Gene Product Result for
Synonyms: HNRNPG HNRPG RBMXP1 RBMXRT RNMX hnRNP-G
Gene ID:
Human(27316) Summary: This gene belongs to the RBMY gene family which includes candidate Y chromosome spermatogenesis genes. This gene, an active X chromosome homolog of the Y chromosome RBMY gene, is widely expressed whereas the RBMY gene evolved a male-specific function in spermatogenesis. Pseudogenes of this gene, found on chromosomes 1, 4, 9, 11, and 6, were likely derived by retrotransposition from the original gene. Alternatively spliced transcript variants encoding different isoforms have been identified. A snoRNA gene (SNORD61) is found in one of its introns. [provided by RefSeq, Sep 2009]
Mouse(19655) RNA binding motif protein, X chromosome
Rat(302855) RNA binding motif protein, X-linked
Zebrafish(321860) RNA binding motif protein, X-linked
chicken(422248) RNA binding motif protein, X-linked
domestic cat(101099282) RNA binding motif protein, X-linked
Horse(100054583) RNA binding motif protein, X-linked
dog(481063) RNA binding motif protein, X-linked
domestic guinea pig(100733384) RNA binding motif protein, X-linked
naked mole-rat(101699169) RNA binding motif protein, X-linked
cow(509591) RNA binding motif protein, X-linked
sheep(101103540) RNA binding motif protein, X-linked
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501209 Anti-HNRNP G antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing
SAB2107655 Anti-RBMX antibody produced in rabbit affinity isolated antibody dog, rat, human, guinea pig, horse, rabbit, mouse, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002139 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU196771 MISSION® esiRNA esiRNA targeting mouse Rbmx mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002139 Rosetta Predictions human pricing
NM_001025663 Rosetta Predictions rat pricing
NM_011252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069732 predicted 980
2 SASI_Hs01_00069733 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060932 predicted 207
2 SASI_Rn01_00060934 predicted 965
3 SASI_Rn02_00203246 predicted 960
4 SASI_Rn01_00060935 predicted 790
5 SASI_Rn02_00203247 predicted 1277
6 SASI_Rn02_00203248 predicted 323
7 SASI_Rn02_00203249 predicted 243
8 SASI_Rn01_00060940 predicted 841
9 SASI_Rn02_00203250 predicted 1093
10 SASI_Rn02_00203251 predicted 771
11 SASI_Rn01_00060933 predicted 1075
12 SASI_Rn01_00060936 predicted 910
13 SASI_Rn01_00060937 predicted 934
14 SASI_Rn01_00060938 predicted 884
15 SASI_Rn01_00060939 predicted 951
16 SASI_Rn01_00060941 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066438 predicted 862
2 SASI_Mm01_00066439 predicted 296
3 SASI_Mm01_00066440 predicted 1051
4 SASI_Mm01_00066441 predicted 244
5 SASI_Mm01_00066442 predicted 1430
6 SASI_Mm01_00066443 predicted 1152
7 SASI_Mm01_00066444 predicted 1368
8 SASI_Mm02_00320256 predicted 946
9 SASI_Mm01_00066446 predicted 972
10 SASI_Mm01_00066447 predicted 326
11 SASI_Mm01_00066445 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011252
RBMX MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011252.2-1714s1c1
Sequence:CCGGCCCAAGATCATCCACAAACTTCTCGAGAAGTTTGTGGATGATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-983s1c1
Sequence:CCGGCTATAGTGATAGAGATGGCTACTCGAGTAGCCATCTCTATCACTATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-850s1c1
Sequence:CCGGCCACTAAAGACAGCTATTCAACTCGAGTTGAATAGCTGTCTTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-333s1c1
Sequence:CCGGCGAGAAACGAATAAGTCAAGACTCGAGTCTTGACTTATTCGTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011252.4-238s21c1
Sequence:CCGGCTTTATTGGTGGGCTTAATACCTCGAGGTATTAAGCCCACCAATAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-276s1c1
Sequence:CCGGCTTGAGGCAGTGTTTGGCAAACTCGAGTTTGCCAAACACTGCCTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011252.4-1148s21c1
Sequence:CCGGAGCAGCTCACGTGACGGATATCTCGAGATATCCGTCACGTGAGCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011252.4-1817s21c1
Sequence:CCGGTTGGTTGGGTGTGCTACTTTCCTCGAGGAAAGTAGCACACCCAACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011252.4-1624s21c1
Sequence:CCGGACTTGTTCCTAGTGTTGTAATCTCGAGATTACAACACTAGGAACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011252
RBMX MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011252.2-1714s1c1
Sequence:CCGGCCCAAGATCATCCACAAACTTCTCGAGAAGTTTGTGGATGATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-983s1c1
Sequence:CCGGCTATAGTGATAGAGATGGCTACTCGAGTAGCCATCTCTATCACTATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-850s1c1
Sequence:CCGGCCACTAAAGACAGCTATTCAACTCGAGTTGAATAGCTGTCTTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-333s1c1
Sequence:CCGGCGAGAAACGAATAAGTCAAGACTCGAGTCTTGACTTATTCGTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011252.4-238s21c1
Sequence:CCGGCTTTATTGGTGGGCTTAATACCTCGAGGTATTAAGCCCACCAATAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-276s1c1
Sequence:CCGGCTTGAGGCAGTGTTTGGCAAACTCGAGTTTGCCAAACACTGCCTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011252.4-1148s21c1
Sequence:CCGGAGCAGCTCACGTGACGGATATCTCGAGATATCCGTCACGTGAGCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011252.4-1817s21c1
Sequence:CCGGTTGGTTGGGTGTGCTACTTTCCTCGAGGAAAGTAGCACACCCAACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011252.4-1624s21c1
Sequence:CCGGACTTGTTCCTAGTGTTGTAATCTCGAGATTACAACACTAGGAACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011252
RBMX MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011252.2-1714s1c1
Sequence:CCGGCCCAAGATCATCCACAAACTTCTCGAGAAGTTTGTGGATGATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-983s1c1
Sequence:CCGGCTATAGTGATAGAGATGGCTACTCGAGTAGCCATCTCTATCACTATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-850s1c1
Sequence:CCGGCCACTAAAGACAGCTATTCAACTCGAGTTGAATAGCTGTCTTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-333s1c1
Sequence:CCGGCGAGAAACGAATAAGTCAAGACTCGAGTCTTGACTTATTCGTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011252.4-238s21c1
Sequence:CCGGCTTTATTGGTGGGCTTAATACCTCGAGGTATTAAGCCCACCAATAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011252.2-276s1c1
Sequence:CCGGCTTGAGGCAGTGTTTGGCAAACTCGAGTTTGCCAAACACTGCCTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011252.4-1148s21c1
Sequence:CCGGAGCAGCTCACGTGACGGATATCTCGAGATATCCGTCACGTGAGCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011252.4-1817s21c1
Sequence:CCGGTTGGTTGGGTGTGCTACTTTCCTCGAGGAAAGTAGCACACCCAACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011252.4-1624s21c1
Sequence:CCGGACTTGTTCCTAGTGTTGTAATCTCGAGATTACAACACTAGGAACAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002139
VALIDATED
RBMX MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-841s21c1
Sequence:CCGGGATGATGGGTATTCTACTAAACTCGAGTTTAGTAGAATACCCATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-603s1c1
Sequence:CCGGCGGTGGATATTCCATGAATTTCTCGAGAAATTCATGGAATATCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-977s1c1
Sequence:CCGGCATCAAGAGGATATAGCGATACTCGAGTATCGCTATATCCTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002139.2-1879s1c1
Sequence:CCGGGCCTATGTAAGGAAAGTGCTACTCGAGTAGCACTTTCCTTACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-806s1c1
Sequence:CCGGTGCCCTCTCGTAGAGATGTTTCTCGAGAAACATCTCTACGAGAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-280s1c1
Sequence:CCGGCTTGAAGCAGTATTTGGCAAACTCGAGTTTGCCAAATACTGCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-1007s21c1
Sequence:CCGGATGGTCGTGATCGTGACTATTCTCGAGAATAGTCACGATCACGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002139.2-1881s21c1
Sequence:CCGGCTATGTAAGGAAAGTGCTATTCTCGAGAATAGCACTTTCCTTACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-760s21c1
Sequence:CCGGTCACGTGGAAGAGATAGTTATCTCGAGATAACTATCTCTTCCACGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-593s21c1
Sequence:CCGGACATGGATGACGGTGGATATTCTCGAGAATATCCACCGTCATCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002139
VALIDATED
RBMX MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-841s21c1
Sequence:CCGGGATGATGGGTATTCTACTAAACTCGAGTTTAGTAGAATACCCATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-603s1c1
Sequence:CCGGCGGTGGATATTCCATGAATTTCTCGAGAAATTCATGGAATATCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-977s1c1
Sequence:CCGGCATCAAGAGGATATAGCGATACTCGAGTATCGCTATATCCTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002139.2-1879s1c1
Sequence:CCGGGCCTATGTAAGGAAAGTGCTACTCGAGTAGCACTTTCCTTACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-806s1c1
Sequence:CCGGTGCCCTCTCGTAGAGATGTTTCTCGAGAAACATCTCTACGAGAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-280s1c1
Sequence:CCGGCTTGAAGCAGTATTTGGCAAACTCGAGTTTGCCAAATACTGCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-1007s21c1
Sequence:CCGGATGGTCGTGATCGTGACTATTCTCGAGAATAGTCACGATCACGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002139.2-1881s21c1
Sequence:CCGGCTATGTAAGGAAAGTGCTATTCTCGAGAATAGCACTTTCCTTACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-760s21c1
Sequence:CCGGTCACGTGGAAGAGATAGTTATCTCGAGATAACTATCTCTTCCACGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-593s21c1
Sequence:CCGGACATGGATGACGGTGGATATTCTCGAGAATATCCACCGTCATCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002139
VALIDATED
RBMX MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-841s21c1
Sequence:CCGGGATGATGGGTATTCTACTAAACTCGAGTTTAGTAGAATACCCATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-603s1c1
Sequence:CCGGCGGTGGATATTCCATGAATTTCTCGAGAAATTCATGGAATATCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-977s1c1
Sequence:CCGGCATCAAGAGGATATAGCGATACTCGAGTATCGCTATATCCTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002139.2-1879s1c1
Sequence:CCGGGCCTATGTAAGGAAAGTGCTACTCGAGTAGCACTTTCCTTACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-806s1c1
Sequence:CCGGTGCCCTCTCGTAGAGATGTTTCTCGAGAAACATCTCTACGAGAGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002139.2-280s1c1
Sequence:CCGGCTTGAAGCAGTATTTGGCAAACTCGAGTTTGCCAAATACTGCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-1007s21c1
Sequence:CCGGATGGTCGTGATCGTGACTATTCTCGAGAATAGTCACGATCACGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002139.2-1881s21c1
Sequence:CCGGCTATGTAAGGAAAGTGCTATTCTCGAGAATAGCACTTTCCTTACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-760s21c1
Sequence:CCGGTCACGTGGAAGAGATAGTTATCTCGAGATAACTATCTCTTCCACGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002139.2-593s21c1
Sequence:CCGGACATGGATGACGGTGGATATTCTCGAGAATATCCACCGTCATCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)