EMAIL THIS PAGE TO A FRIEND

RBMXL1

RNA binding motif protein, X-linked-like 1

107 Gene Product Result for
Synonyms: RBM1
UniProtKB ID: Q96E39
Gene ID:
Human(494115) Summary: This gene represents a retrogene of RNA binding motif protein, X-linked (RBMX), which is located on chromosome X. While all introns in the coding sequence have been processed out compared to the RBMX locus, the ORF is intact and there is specific evidence for transcription at this location. The preservation of the ORF by purifying selection in all Old World monkeys carrying it suggests that this locus is likely to be functional, possibly during male meiosis when X chromosomal genes are silenced or during haploid stages of spermatogenesis. This gene shares 5' exon structure with the cysteine conjugate-beta lyase 2 locus on chromosome 1, but the coding sequences are non-overlapping. Alternative splicing results in two transcript variants. [provided by RefSeq, Jun 2009]
Mouse(19656) RNA binding motif protein, X linked-like-1
Rat(680944) RNA binding motif protein, X-linked-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305868 ANTI-RBMXL1 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009033 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009033 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009033 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU202871 MISSION® esiRNA esiRNA targeting mouse Rbmxrt mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001058360 Rosetta Predictions rat pricing
XM_001058419 Rosetta Predictions rat pricing
NM_009033 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058360 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289421 predicted 376
2 SASI_Rn02_00289422 predicted 1035
3 SASI_Rn02_00289423 predicted 913
4 SASI_Rn02_00289424 predicted 329
5 SASI_Rn02_00289425 predicted 574
6 SASI_Rn02_00289426 predicted 372
7 SASI_Rn02_00289427 predicted 668
8 SASI_Rn02_00289428 predicted 750
9 SASI_Rn02_00289429 predicted 579
10 SASI_Rn02_00289430 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289663 predicted 422
2 SASI_Rn02_00289664 predicted 1077
3 SASI_Rn02_00289665 predicted 952
4 SASI_Rn02_00289666 predicted 369
5 SASI_Rn02_00289667 predicted 624
6 SASI_Rn02_00289668 predicted 420
7 SASI_Rn02_00289669 predicted 707
8 SASI_Rn02_00289670 predicted 794
9 SASI_Rn02_00289671 predicted 615
10 SASI_Rn02_00289672 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009033 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197110 predicted 1060
2 SASI_Mm01_00197111 predicted 1490
3 SASI_Mm01_00197112 predicted 1450
4 SASI_Mm01_00197115 predicted 1116
5 SASI_Mm01_00197116 predicted 1464
6 SASI_Mm01_00197118 predicted 662
7 SASI_Mm01_00197119 predicted 957
8 SASI_Mm02_00315189 predicted 345
9 SASI_Mm01_00197113 predicted 409
10 SASI_Mm01_00197114 predicted 317
11 SASI_Mm01_00197117 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009033
VALIDATED
RBMXL1 MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, X-linked-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-511s1c1
Sequence:CCGGCGTGGAGGATACATGGATGATCTCGAGATCATCCATGTATCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009033.1-1037s1c1
Sequence:CCGGCACCACCATCTTATGGAGGAACTCGAGTTCCTCCATAAGATGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-914s1c1
Sequence:CCGGGCTACGGTGATAGAGATGGATCTCGAGATCCATCTCTATCACCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-655s21c1
Sequence:CCGGACATGGATGATGGTGGTTATTCTCGAGAATAACCACCATCATCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-1343s1c1
Sequence:CCGGCCATGCAAAGAAACAAAGGATCTCGAGATCCTTTGTTTCTTTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-340s1c1
Sequence:CCGGGCAGCTAGAGATATGAATGGACTCGAGTCCATTCATATCTCTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-1048s21c1
Sequence:CCGGGCTACGGTGATAGAGATGGATCTCGAGATCCATCTCTATCACCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009033.2-953s21c1
Sequence:CCGGCTCCCGAGACACCAGAGATTACTCGAGTAATCTCTGGTGTCTCGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-1496s21c1
Sequence:CCGGATGGAAAGTCTTCTGTCATAACTCGAGTTATGACAGAAGACTTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-989s21c1
Sequence:CCGGAGATTATACTTACCGTGATTACTCGAGTAATCACGGTAAGTATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009033
VALIDATED
RBMXL1 MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, X-linked-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-511s1c1
Sequence:CCGGCGTGGAGGATACATGGATGATCTCGAGATCATCCATGTATCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009033.1-1037s1c1
Sequence:CCGGCACCACCATCTTATGGAGGAACTCGAGTTCCTCCATAAGATGGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-914s1c1
Sequence:CCGGGCTACGGTGATAGAGATGGATCTCGAGATCCATCTCTATCACCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-655s21c1
Sequence:CCGGACATGGATGATGGTGGTTATTCTCGAGAATAACCACCATCATCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-1343s1c1
Sequence:CCGGCCATGCAAAGAAACAAAGGATCTCGAGATCCTTTGTTTCTTTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-340s1c1
Sequence:CCGGGCAGCTAGAGATATGAATGGACTCGAGTCCATTCATATCTCTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-1048s21c1
Sequence:CCGGGCTACGGTGATAGAGATGGATCTCGAGATCCATCTCTATCACCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009033.2-953s21c1
Sequence:CCGGCTCCCGAGACACCAGAGATTACTCGAGTAATCTCTGGTGTCTCGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-1496s21c1
Sequence:CCGGATGGAAAGTCTTCTGTCATAACTCGAGTTATGACAGAAGACTTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-989s21c1
Sequence:CCGGAGATTATACTTACCGTGATTACTCGAGTAATCACGGTAAGTATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009033
VALIDATED
RBMXL1 MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, X-linked-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-511s1c1
Sequence:CCGGCGTGGAGGATACATGGATGATCTCGAGATCATCCATGTATCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009033.1-1037s1c1
Sequence:CCGGCACCACCATCTTATGGAGGAACTCGAGTTCCTCCATAAGATGGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-914s1c1
Sequence:CCGGGCTACGGTGATAGAGATGGATCTCGAGATCCATCTCTATCACCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-655s21c1
Sequence:CCGGACATGGATGATGGTGGTTATTCTCGAGAATAACCACCATCATCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-1343s1c1
Sequence:CCGGCCATGCAAAGAAACAAAGGATCTCGAGATCCTTTGTTTCTTTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009033.1-340s1c1
Sequence:CCGGGCAGCTAGAGATATGAATGGACTCGAGTCCATTCATATCTCTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-1048s21c1
Sequence:CCGGGCTACGGTGATAGAGATGGATCTCGAGATCCATCTCTATCACCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009033.2-953s21c1
Sequence:CCGGCTCCCGAGACACCAGAGATTACTCGAGTAATCTCTGGTGTCTCGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313932    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-1496s21c1
Sequence:CCGGATGGAAAGTCTTCTGTCATAACTCGAGTTATGACAGAAGACTTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009033.2-989s21c1
Sequence:CCGGAGATTATACTTACCGTGATTACTCGAGTAATCACGGTAAGTATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)