EMAIL THIS PAGE TO A FRIEND

RBMY1B

RNA binding motif protein, Y-linked, family 1, member B

15 Gene Product Result for
Species: Human RBMY1B(378948)
UniProtKB ID: A6NDE4, A6NCZ8, A6NE80, A8MSJ6
Gene ID:
Human(378948) Summary: This gene encodes a protein containing an RNA-binding motif in the N-terminus and four SRGY (serine, arginine, glycine, tyrosine) boxes in the C-terminus. Multiple copies of this gene are found in the AZFb azoospermia factor region of chromosome Y and the encoded protein is thought to be involved in spermatogenesis. Most copies of this locus are pseudogenes, although six highly similar copies have full-length ORFs and are considered functional. Four functional copies of this gene are found within inverted repeat IR2; two functional copies of this gene are found in palindrome P3, along with two copies of PTPN13-like, Y-linked. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006121 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006121 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099812 predicted 957
2 SASI_Hs01_00099813 predicted 1065
3 SASI_Hs01_00099814 predicted 966
4 SASI_Hs01_00099815 predicted 960
5 SASI_Hs01_00099816 predicted 892
6 SASI_Hs01_00099817 predicted 886
7 SASI_Hs01_00099818 predicted 532
8 SASI_Hs01_00099819 predicted 1037
9 SASI_Hs01_00099820 predicted 913
10 SASI_Hs01_00099821 predicted 830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006121
RBMY1B MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, Y-linked, family 1, member B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-966s1c1
Sequence:CCGGCTCGTCGGGATGAAAGTTATTCTCGAGAATAACTTTCATCCCGACGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006121.1-527s1c1
Sequence:CCGGCCTGATCTCAAGATGAGTTATCTCGAGATAACTCATCTTGAGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006121.1-1727s1c1
Sequence:CCGGGAGAGAGGTAGATACTAACTTCTCGAGAAGTTAGTATCTACCTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-993s1c1
Sequence:CCGGGATACAGAAATCGTCGAAGTTCTCGAGAACTTCGACGATTTCTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006121.1-1737s1c1
Sequence:CCGGGATACTAACTTCCTCCATGAACTCGAGTTCATGGAGGAAGTTAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-742s1c1
Sequence:CCGGGTCAACAAGACATGATGGTTACTCGAGTAACCATCATGTCTTGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006121.1-258s1c1
Sequence:CCGGCCAGAGGCTTTGCATTTATTACTCGAGTAATAAATGCAAAGCCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006121
RBMY1B MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, Y-linked, family 1, member B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-966s1c1
Sequence:CCGGCTCGTCGGGATGAAAGTTATTCTCGAGAATAACTTTCATCCCGACGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006121.1-527s1c1
Sequence:CCGGCCTGATCTCAAGATGAGTTATCTCGAGATAACTCATCTTGAGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006121.1-1727s1c1
Sequence:CCGGGAGAGAGGTAGATACTAACTTCTCGAGAAGTTAGTATCTACCTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-993s1c1
Sequence:CCGGGATACAGAAATCGTCGAAGTTCTCGAGAACTTCGACGATTTCTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006121.1-1737s1c1
Sequence:CCGGGATACTAACTTCCTCCATGAACTCGAGTTCATGGAGGAAGTTAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-742s1c1
Sequence:CCGGGTCAACAAGACATGATGGTTACTCGAGTAACCATCATGTCTTGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006121.1-258s1c1
Sequence:CCGGCCAGAGGCTTTGCATTTATTACTCGAGTAATAAATGCAAAGCCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006121
RBMY1B MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, Y-linked, family 1, member B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-966s1c1
Sequence:CCGGCTCGTCGGGATGAAAGTTATTCTCGAGAATAACTTTCATCCCGACGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006121.1-527s1c1
Sequence:CCGGCCTGATCTCAAGATGAGTTATCTCGAGATAACTCATCTTGAGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006121.1-1727s1c1
Sequence:CCGGGAGAGAGGTAGATACTAACTTCTCGAGAAGTTAGTATCTACCTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-993s1c1
Sequence:CCGGGATACAGAAATCGTCGAAGTTCTCGAGAACTTCGACGATTTCTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006121.1-1737s1c1
Sequence:CCGGGATACTAACTTCCTCCATGAACTCGAGTTCATGGAGGAAGTTAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006121.1-742s1c1
Sequence:CCGGGTCAACAAGACATGATGGTTACTCGAGTAACCATCATGTCTTGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006121.1-258s1c1
Sequence:CCGGCCAGAGGCTTTGCATTTATTACTCGAGTAATAAATGCAAAGCCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)