EMAIL THIS PAGE TO A FRIEND

RBMY1J

RNA binding motif protein, Y-linked, family 1, member J

15 Gene Product Result for
Species: Human RBMY1J(378951)
Gene ID:
Human(378951) Summary: This gene encodes a protein containing an RNA-binding motif in the N-terminus and four SRGY (serine, arginine, glycine, tyrosine) boxes in the C-terminus. Multiple copies of this gene are found in the AZFb azoospermia factor region of chromosome Y and the encoded protein is thought to be involved in spermatogenesis. Most copies of this locus are pseudogenes, although six highly similar copies have full-length ORFs and are considered functional. Four functional copies of this gene are found within inverted repeat IR2; two functional copies of this gene are found in palindrome P3, along with two copies of PTPN13-like, Y-linked. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001006117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006117 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099097 predicted 951
2 SASI_Hs02_00305068 predicted 1057
3 SASI_Hs01_00099098 predicted 1370
4 SASI_Hs01_00099099 predicted 959
5 SASI_Hs01_00099100 predicted 1263
6 SASI_Hs01_00099101 predicted 946
7 SASI_Hs01_00099102 predicted 879
8 SASI_Hs01_00099103 predicted 884
9 SASI_Hs01_00099105 predicted 1364
10 SASI_Hs01_00099104 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006117
RBMY1J MISSION shRNA Bacterial Glycerol Stock
RNA binding motif protein, Y-linked, family 1, member J
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-289s1c1
Sequence:CCGGGATGCTAAGAATGCTGCGAAACTCGAGTTTCGCAGCATTCTTAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006117.2-1526s1c1
Sequence:CCGGGTAGCTCAAGTTATGTGGCATCTCGAGATGCCACATAACTTGAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-172s1c1
Sequence:CCGGGAGAAGATGCTTAAAGCAGTACTCGAGTACTGCTTTAAGCATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-743s1c1
Sequence:CCGGGACATGATGGTTATGCAACTACTCGAGTAGTTGCATAACCATCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-937s1c1
Sequence:CCGGGCATACCGTGATTATGGTCATCTCGAGATGACCATAATCACGGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-505s1c1
Sequence:CCGGGATGGTGGATACACTCCTGATCTCGAGATCAGGAGTGTATCCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006117
RBMY1J MISSION shRNA shRNA Plasmid DNA
RNA binding motif protein, Y-linked, family 1, member J
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-289s1c1
Sequence:CCGGGATGCTAAGAATGCTGCGAAACTCGAGTTTCGCAGCATTCTTAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006117.2-1526s1c1
Sequence:CCGGGTAGCTCAAGTTATGTGGCATCTCGAGATGCCACATAACTTGAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-172s1c1
Sequence:CCGGGAGAAGATGCTTAAAGCAGTACTCGAGTACTGCTTTAAGCATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-743s1c1
Sequence:CCGGGACATGATGGTTATGCAACTACTCGAGTAGTTGCATAACCATCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-937s1c1
Sequence:CCGGGCATACCGTGATTATGGTCATCTCGAGATGACCATAATCACGGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-505s1c1
Sequence:CCGGGATGGTGGATACACTCCTGATCTCGAGATCAGGAGTGTATCCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006117
RBMY1J MISSION shRNA Lentiviral Transduction Particles
RNA binding motif protein, Y-linked, family 1, member J
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-289s1c1
Sequence:CCGGGATGCTAAGAATGCTGCGAAACTCGAGTTTCGCAGCATTCTTAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006117.2-1526s1c1
Sequence:CCGGGTAGCTCAAGTTATGTGGCATCTCGAGATGCCACATAACTTGAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-172s1c1
Sequence:CCGGGAGAAGATGCTTAAAGCAGTACTCGAGTACTGCTTTAAGCATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-743s1c1
Sequence:CCGGGACATGATGGTTATGCAACTACTCGAGTAGTTGCATAACCATCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-937s1c1
Sequence:CCGGGCATACCGTGATTATGGTCATCTCGAGATGACCATAATCACGGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006117.2-505s1c1
Sequence:CCGGGATGGTGGATACACTCCTGATCTCGAGATCAGGAGTGTATCCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)