EMAIL THIS PAGE TO A FRIEND

RBP1

retinol binding protein 1, cellular

83 Gene Product Result for
Synonyms: CRABP-I CRBP CRBP1 CRBPI RBPC
UniProtKB ID: P09455, A8K2Q0, B7Z7A0, E7EWV0, F2Z2F2, Q6FGX8
Gene ID:
Human(5947) Summary: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(19659) retinol binding protein 1, cellular
Rat(25056) retinol binding protein 1, cellular
fruit fly(41294) RNA-binding protein 1
dog(477090) retinol binding protein 1, cellular
chicken(424821) retinol binding protein 1, cellular
Thale Cress(842216) RNA-binding protein 1
naked mole-rat(101719271) retinol binding protein 1, cellular
domestic guinea pig(101787202) retinol binding protein 1, cellular
cow(537379) retinol binding protein 1, cellular
sheep(101108977) retinol binding protein 1, cellular
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002899 Rosetta Predictions human pricing
NM_012733 Rosetta Predictions rat pricing
NM_011254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124012 predicted 357
2 SASI_Hs01_00124013 predicted 392
3 SASI_Hs01_00124014 predicted 292
4 SASI_Hs01_00124016 predicted 400
5 SASI_Hs01_00124017 predicted 236
6 SASI_Hs01_00124018 predicted 447
7 SASI_Hs01_00124019 predicted 298
8 SASI_Hs01_00124020 predicted 341
9 SASI_Hs01_00124021 predicted 477
10 SASI_Hs02_00334707 predicted 447
11 SASI_Hs01_00124015 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074096 predicted 329
2 SASI_Rn01_00074097 predicted 266
3 SASI_Rn01_00074098 predicted 414
4 SASI_Rn01_00074099 predicted 463
5 SASI_Rn01_00074102 predicted 416
6 SASI_Rn01_00074103 predicted 208
7 SASI_Rn02_00260078 predicted 412
8 SASI_Rn01_00074104 predicted 462
9 SASI_Rn01_00074105 predicted 267
10 SASI_Rn02_00260079 predicted 306
11 SASI_Rn01_00074100 predicted 361
12 SASI_Rn01_00074101 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166522 predicted 2244
2 SASI_Mm01_00166523 predicted 2339
3 SASI_Mm01_00166524 predicted 2089
4 SASI_Mm01_00166525 predicted 2116
5 SASI_Mm01_00166526 predicted 2044
6 SASI_Mm01_00166527 predicted 2018
7 SASI_Mm01_00166528 predicted 2337
8 SASI_Mm01_00166530 predicted 2382
9 SASI_Mm02_00320258 predicted 2093
10 SASI_Mm02_00320259 predicted 2403
11 SASI_Mm01_00166521 predicted 2113
12 SASI_Mm01_00166529 predicted 2303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002899
VALIDATED
RBP1 MISSION shRNA Bacterial Glycerol Stock
retinol binding protein 1, cellular
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002899.3-717s21c1
Sequence:CCGGACAACCTTGTCCCAAGGAATCCTCGAGGATTCCTTGGGACAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-514s21c1
Sequence:CCGGGAGGATCTGACAGGCATAGATCTCGAGATCTATGCCTGTCAGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-293s21c1
Sequence:CCGGCCGAAATGCCAGTCGACTTCACTCGAGTGAAGTCGACTGGCATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-327s21c1
Sequence:CCGGGATGTTGGTCAACGAGAATTTCTCGAGAAATTCTCGTTGACCAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-497s1c1
Sequence:CCGGTGTGGTCTGCAAGCAAGTATTCTCGAGAATACTTGCTTGCAGACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-164s1c1
Sequence:CCGGCAACGAGAATTTCGAGGAGTACTCGAGTACTCCTCGAAATTCTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002899.2-474s1c1
Sequence:CCGGCACCTAGAGATGAGAGTGGAACTCGAGTTCCACTCTCATCTCTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-155s1c1
Sequence:CCGGGATGTTGGTCAACGAGAATTTCTCGAGAAATTCTCGTTGACCAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-342s1c1
Sequence:CCGGGAGGATCTGACAGGCATAGATCTCGAGATCTATGCCTGTCAGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-669s21c1
Sequence:CCGGTGTGGTCTGCAAGCAAGTATTCTCGAGAATACTTGCTTGCAGACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002899
VALIDATED
RBP1 MISSION shRNA shRNA Plasmid DNA
retinol binding protein 1, cellular
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002899.3-717s21c1
Sequence:CCGGACAACCTTGTCCCAAGGAATCCTCGAGGATTCCTTGGGACAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-514s21c1
Sequence:CCGGGAGGATCTGACAGGCATAGATCTCGAGATCTATGCCTGTCAGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-293s21c1
Sequence:CCGGCCGAAATGCCAGTCGACTTCACTCGAGTGAAGTCGACTGGCATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-327s21c1
Sequence:CCGGGATGTTGGTCAACGAGAATTTCTCGAGAAATTCTCGTTGACCAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-497s1c1
Sequence:CCGGTGTGGTCTGCAAGCAAGTATTCTCGAGAATACTTGCTTGCAGACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-164s1c1
Sequence:CCGGCAACGAGAATTTCGAGGAGTACTCGAGTACTCCTCGAAATTCTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002899.2-474s1c1
Sequence:CCGGCACCTAGAGATGAGAGTGGAACTCGAGTTCCACTCTCATCTCTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-155s1c1
Sequence:CCGGGATGTTGGTCAACGAGAATTTCTCGAGAAATTCTCGTTGACCAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-342s1c1
Sequence:CCGGGAGGATCTGACAGGCATAGATCTCGAGATCTATGCCTGTCAGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-669s21c1
Sequence:CCGGTGTGGTCTGCAAGCAAGTATTCTCGAGAATACTTGCTTGCAGACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002899
VALIDATED
RBP1 MISSION shRNA Lentiviral Transduction Particles
retinol binding protein 1, cellular
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002899.3-717s21c1
Sequence:CCGGACAACCTTGTCCCAAGGAATCCTCGAGGATTCCTTGGGACAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-514s21c1
Sequence:CCGGGAGGATCTGACAGGCATAGATCTCGAGATCTATGCCTGTCAGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-293s21c1
Sequence:CCGGCCGAAATGCCAGTCGACTTCACTCGAGTGAAGTCGACTGGCATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-327s21c1
Sequence:CCGGGATGTTGGTCAACGAGAATTTCTCGAGAAATTCTCGTTGACCAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-497s1c1
Sequence:CCGGTGTGGTCTGCAAGCAAGTATTCTCGAGAATACTTGCTTGCAGACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-164s1c1
Sequence:CCGGCAACGAGAATTTCGAGGAGTACTCGAGTACTCCTCGAAATTCTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002899.2-474s1c1
Sequence:CCGGCACCTAGAGATGAGAGTGGAACTCGAGTTCCACTCTCATCTCTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-155s1c1
Sequence:CCGGGATGTTGGTCAACGAGAATTTCTCGAGAAATTCTCGTTGACCAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002899.2-342s1c1
Sequence:CCGGGAGGATCTGACAGGCATAGATCTCGAGATCTATGCCTGTCAGATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002899.3-669s21c1
Sequence:CCGGTGTGGTCTGCAAGCAAGTATTCTCGAGAATACTTGCTTGCAGACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011254
RBP1 MISSION shRNA Bacterial Glycerol Stock
retinol binding protein 1, cellular
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2231s1c1
Sequence:CCGGGAGGAAGATCTGACAGGCATACTCGAGTATGCCTGTCAGATCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011254.3-2441s1c1
Sequence:CCGGCGAGGAGATAACCTTGGTCTTCTCGAGAAGACCAAGGTTATCTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2191s1c1
Sequence:CCGGTCGGAACTATATCATGGACTTCTCGAGAAGTCCATGATATAGTTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2389s1c1
Sequence:CCGGTGTGATCTGCAAGCAAGTGTTCTCGAGAACACTTGCTTGCAGATCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2055s1c1
Sequence:CCGGGCAATGAGAATTTCGAGGAGTCTCGAGACTCCTCGAAATTCTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011254
RBP1 MISSION shRNA shRNA Plasmid DNA
retinol binding protein 1, cellular
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2231s1c1
Sequence:CCGGGAGGAAGATCTGACAGGCATACTCGAGTATGCCTGTCAGATCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011254.3-2441s1c1
Sequence:CCGGCGAGGAGATAACCTTGGTCTTCTCGAGAAGACCAAGGTTATCTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2191s1c1
Sequence:CCGGTCGGAACTATATCATGGACTTCTCGAGAAGTCCATGATATAGTTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2389s1c1
Sequence:CCGGTGTGATCTGCAAGCAAGTGTTCTCGAGAACACTTGCTTGCAGATCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2055s1c1
Sequence:CCGGGCAATGAGAATTTCGAGGAGTCTCGAGACTCCTCGAAATTCTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011254
RBP1 MISSION shRNA Lentiviral Transduction Particles
retinol binding protein 1, cellular
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2231s1c1
Sequence:CCGGGAGGAAGATCTGACAGGCATACTCGAGTATGCCTGTCAGATCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011254.3-2441s1c1
Sequence:CCGGCGAGGAGATAACCTTGGTCTTCTCGAGAAGACCAAGGTTATCTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2191s1c1
Sequence:CCGGTCGGAACTATATCATGGACTTCTCGAGAAGTCCATGATATAGTTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2389s1c1
Sequence:CCGGTGTGATCTGCAAGCAAGTGTTCTCGAGAACACTTGCTTGCAGATCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011254.3-2055s1c1
Sequence:CCGGGCAATGAGAATTTCGAGGAGTCTCGAGACTCCTCGAAATTCTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)